vidjil-algo 2020.08
Command-line manual
The Vidjil team (Mathieu, Mikaël, Aurélien, Florian, Marc, Tatiana and Rayan)
Vidjil -- High-throughput Analysis of V(D)J Immune Repertoire -- [[http://www.vidjil.org]]
Copyright (C) 2011-2020 by Bonsai bioinformatics
at CRIStAL (UMR CNRS 9189, Université Lille) and Inria Lille
and VidjilNet consortium.
contact@vidjil.org
This is the help of vidjil-algo, for command-line usage. This manual can be browsed online:
- http://www.vidjil.org/doc/vidjil-algo (last stable release)
- http://gitlab.vidjil.org/blob/dev/doc/vidjil-algo.md (development version)
Other documentation (users and administrators of the web application, developpers) can be found from http://www.vidjil.org/doc/.
About
V(D)J recombinations in lymphocytes are essential for immunological diversity. They are also useful markers of pathologies, and in leukemia, are used to quantify the minimal residual disease during patient follow-up. With adapted library preparation and sequencing, high-throughput sequencing (NGS/HTS) now enables the deep sequencing of a lymphoid population with dedicated sequencing methods and software, called either Rep-Seq or AIRR-Seq.
Vidjil-algo processes high-throughput sequencing data to extract V(D)J junctions and gather them into clones. Vidjil-algo starts from a set of reads and detects "windows" overlapping the actual CDR3. This is based on an fast and reliable seed-based heuristic and allows to output all sequenced clones. The analysis is extremely fast because, in the first phase, no alignment is performed with database germline sequences. At the end, only the consensus sequences of each clone have to be analyzed. Vidjil-algo can also cluster similar clones, or leave this to the user after a manual review in the web application.
The method is described in the following references:
-
Marc Duez et al., “Vidjil: A web platform for analysis of high-throughput repertoire sequencing”, PLOS ONE 2016, 11(11):e0166126 http://dx.doi.org/10.1371/journal.pone.0166126
-
Mathieu Giraud, Mikaël Salson, et al., "Fast multiclonal clusterization of V(D)J recombinations from high-throughput sequencing", BMC Genomics 2014, 15:409 http://dx.doi.org/10.1186/1471-2164-15-409
Vidjil-algo is open-source, released under GNU GPLv3+ license.
Requirements and installation
Supported platforms
Vidjil-algo is systematically tested with the following compilers :
- gcc/g++ 4.8, 5.3, 6.3, 7.3, 8.4, 9.3, 10.1
- clang 3.4, 4.0, 6.0, 7.0
These compilers are available on recent OS X and on the following Linux distributions: - CentOS 7, 8 - Debian Jessie 8.0, Stretch 9.0, Buster 10.0 - FreeBSD 9.2, 10, 11, 12 - Ubuntu 16.04 LTS, 18.04 LTS, 20.04 LTS
Vidjil-algo is developed with continuous integration using systematic unit and functional testing.
The development team internally uses Gitlab CI for that,
and the tested compilers are run through Docker containers described in .gitlab-ci-compilers.yml
.
Build requirements (optional)
This paragraph details the requirements to build Vidjil-algo from source. You can also download a static binary, see installation.
To compile Vidjil-algo, make sure:
- to be on a POSIX system ;
- to have a C++11 compiler (as
g++
4.8 or above, orclang
3.4 or above). - to have the
zlib
installed (zlib1g-dev
package under Debian/Ubuntu,zlib-devel
package under Fedora/CentOS). - to have GNU make (
gmake
under FreeBSD). On some FreeBSD distributions, it was required to use commands such as
make MAKE=gmake CXXFLAGS="-std=c++11 -O2 Wall -D_GLIBCXX_USE_C99 -Wl,-rpath=/usr/local/lib/gcc49"
The `gcc49` at the end of the command line is to be replaced by the `gcc` version used.
Installation
Download
These instructions targets stable releases of vidjil-algo, as downloaded from http://www.vidjil.org/releases or http://bioinfo.lifl.fr/vidjil/.
Development code is found at http://gitlab.vidjil.org, in the algo
directory.
and compiling and running vidjil-algo on the development code can involve slightly different commands,
including replacing src
by algo
.
Compiling
Running make
from the extracted archive should be enough to install vidjil-algo with germline and demo files.
It runs the three following make
commands.
make germline
# get IMGT germline databases (IMGT/GENE-DB) -- you have to agree to IMGT license:
# academic research only, provided that it is referred to IMGT®,
# and cited as "IMGT®, the international ImMunoGeneTics information system®
# http://www.imgt.org (founder and director: Marie-Paule Lefranc, Montpellier, France).
# Lefranc, M.-P., IMGT®, the international ImMunoGeneTics database,
# Nucl. Acids Res., 29, 207-209 (2001). PMID: 11125093
make -C src # build vijil-algo from the sources (see the requirements,
# another option is: wget http://www.vidjil.org/releases/vidjil-algo-latest_x86_64 -O vidjil-algo
# to download a static binary (built for x86_64 architectures)
make demo # download demo files (S22 and L4, see demo/get-sequences)
./vidjil-algo -h # display help/usage
On some older systems you may need to replace the make
commands with:
make LDFLAGS='-stdlib=libc++' ### OS X Mavericks
Self-tests (optional)
You can run the tests with the following commands:
make -C src/tests/data
# get IGH recombinations from a single individual, as described in:
# Boyd, S. D., and al. Individual variation in the germline Ig gene
# repertoire inferred from variable region gene rearrangements. J
# Immunol, 184(12), 6986–92.
make -C src test # run self-tests (can take 5 to 60 minutes)
Input and parameters
The main input file of Vidjil-algo is a set of reads, given as a .fasta
or .fastq
file, possibly compressed with gzip (.gz
).
This set of reads can reach several gigabytes and 2*109 reads. It is
never loaded entirely in the memory, but reads are processed one by
one by Vidjil-algo.
Vidjil-algo can also process BAM files, but please note that:
- The reads don't need to be aligned beforehand.
- In case of paired-end sequencing, the reads must have already been merged in the BAM file.
The -h
and -H
help options provide the list of parameters that can be
used. We detail here the options of the main -c clones
command.
The default options are very conservative (large window, no further automatic clusterization, see below), leaving the user or other software making detailed analysis and decisions on the final clustering.
Germline presets: locus and recombination selection
Germline/recombination selection (at least one -g or -V/(-D)/-J option must be given)
-g, --germline GERMLINES ...
-g <.g FILE>(:FOCUS) ...
germline preset(s) (.g file(s)), detecting multiple recombinations, with tuned parameters.
Common values are '-g germline/homo-sapiens.g' or '-g germline/mus-musculus.g'
One can focus on some recombinations, such as in '-g germline/homo-sapiens.g:IGH,IGK,IGL'
-g PATH
human germline preset, shortcut for '-g PATH/homo-sapiens.g',
processes human TRA, TRB, TRG, TRD, IGH, IGK and IGL locus, possibly with incomplete/unusal recombinations
-V FILE ... custom V germline multi-fasta file(s)
-D FILE ... custom D germline multi-fasta file(s) for V(D)J designation
-J FILE ... custom V germline multi-fasta file(s)
-2 try to detect unexpected recombinations
The germline/*.g
presets configure the analyzed recombinations.
The following presets are provided:
germline/homo-sapiens.g
: Homo sapiens, TR (TRA
,TRB
,TRG
,TRD
) and Ig (IGH
,IGK
,IGL
) locus, including incomplete/unusal recombinations (TRA+D
,TRB+
,TRD+
,IGH+
,IGK+
, see. germline/homo-sapiens-isotypes.g
: Homo sapiens heavy chain locus, looking for sequences with, on one side, IGHJ (or even IGHV) genes, and, on the other side, an IGH constant chain.germline/homo-sapiens-isoforms.g
: Homo sapiens IKZF1 and ERG recombinations.germline/homo-sapiens-cd.g
: Homo sapiens, common CD genes (experimental, does not check for recombinations).germline/mus-musculus.g
: Mus musculus (strains BALB/c and C57BL/6)-
germline/rattus-norvegicus.g
: Rattus norvegicus (strains BN/SsNHsdMCW and Sprague-Dawley) -
Recombinations can be filtered, such as in
-g germline/homo-sapiens.g:IGH
(only IGH, complete recombinations),-g germline/homo-sapiens.g:IGH,IGH+
(only IGH, as well with incomplete recombinations) or-g germline/homo-sapiens.g:TRA,TRB,TRG
(only TR locus, complete recombinations). -
Several presets can be loaded at the same time, as for instance
-g germline/homo-sapiens.g -g germline/germline/homo-sapiens-isotypes.g
. -
Using
-2
further test unexpected recombinations (tagged asxxx
), as in-g germline/homo-sapiens.g -2
.
Finally, the advanced -V/(-D)/-J
options enable to select custom V, (D) and J repertoires given as .fasta
files.
Custom germline/*.g
presets
New germline/*.g
presets for other species or for custom recombinations can be created, possibly referring to other .fasta
files.
This is an advanced usage, please contact us if you need help in configuring such other germlines.
Inside a .g
file, the systems
entries details how vidjil-algo looks for recombinations.
Let's look at the IGH
entry in the germline/homo-sapiens.g
preset:
"IGH": {
"shortcut": "H",
"color" : "#6c71c4",
"description": "Human immunoglobulin, heavy locus (14q32.33)",
"recombinations": [ {
"5": ["IGHV.fa"],
"4": ["IGHD.fa"],
"3": ["IGHJ+down.fa"]
} ],
"parameters": {
"seed": "12s"
}
}
The shortcut
must be a unique 1-character string.
The color
and description
fields are not used by vidjil-algo
, but rather by the web application.
The parameters.seed
value of 12s
is equivalent to -s 12s
advanced option on k-mer size described below.
Here recombinations
describes one sequence analysis mode, called 543
:
a VJ junction is detected when there is a significant similarity (in terms of numbers of k-mers, see below) against sequences in IGHV.fa
in the 5' region,
followed by a significant similarity in the 3' region against sequences in IGHJ+down.fa
– here we take both J genes and downstream sequences to improve the detection.
In a second pass (V(D)J designation), full alignment is done against these sequences.
The optional 4
entry (IGHD.fa
) is taken only there into account.
However, if a D is not detected and designated, the read will be designated as VJ.
The TRD+
entry, for incomplete recombinations (see
"recombinations": [ {
"5": ["TRDV.fa"],
"3": ["TRDD3+down.fa"]
}, {
"5": ["TRDD2+up.fa"],
"4": ["TRDD.fa"],
"3": ["TRDJ+down.fa"]
}, {
"5": ["TRDD2+up.fa"],
"3": ["TRDD3+down.fa"]
} ]
There is also an experimental sequence analysis mode, called 1
,
that detects similarities and designates sequences without recombinations,
as in germline/homo-sapiens-cd.g
:
"recombinations": [ { "1": ["CD-sorting.fa"] } ]
This can be used to detect non-recombined known sequences, as shown here with usual CD sequences in RNA-seq data. However, putting too many sequences here may generate many hits that may hide actual recombinations.
Main algorithm parameters
Recombination detection ("window" prediction, first pass)
(use either -s or -k option, but not both)
(using -k option is equivalent to set with -s a contiguous seed with only '#' characters)
(all these options, except -w, are overriden when using -g)
-k, --kmer INT k-mer size used for the V/J affectation (default: 10, 12, 13, depends on germline)
-w, --window INT w-mer size used for the length of the extracted window ('all': use all the read, no window clustering)
-e, --e-value FLOAT=1 maximal e-value for trusting the detection of a V-J recombination
--trim INT trim V and J genes (resp. 5' and 3' regions) to keep at most <INT> nt (0: no trim)
-s, --seed SEED=10s seed, possibly spaced, used for the V/J affectation (default: depends on germline), given either explicitely or by an alias
10s:#####-##### 12s:######-###### 13s:#######-###### 9c:#########
The -s
, -k
are the options of the seed-based heuristic that detects
"junctions", that is a zone in a read that is similar to V genes on its
left end and similar to J genes in its right end. A detailed
explanation can be found in (Giraud, Salson and al., 2014).
These options are for advanced usage, the default values, as set in the germline/*.g
presets, should work.
The -s
or -k
option selects the seed used for the k-mer V/J affectation.
The -w
option fixes the size of the "window" that is the main
identifier to cluster clones. The default value (-w 50
) was selected
to ensure a high-quality clone clustering: reads are clustered when
they exactly share, at the nucleotide level, a 50 bp-window centered
on the CDR3. No sequencing errors are corrected inside this window.
The center of the "window", predicted by the high-throughput heuristic, may
be shifted by a few bases from the actual "center" of the CDR3 (for TRG,
less than 15 bases compared to the IMGT/V-QUEST or IgBlast prediction
in >99% of cases when the reads are large enough). Usually, a 50 bp-window
fully contains the CDR3 as well as some part of the end of the V and
the start of the J, or at least some specific N region to uniquely identify the clone.
Setting -w
to higher values (such as -w 60
or -w 100
) makes the clone clustering
even more conservative, enabling to split clones with low specificity (such as IGH with very
large D, short or no N regions and almost no somatic hypermutations). However, such settings
may detect recombinations in less reads, depending on the read length of your data, and may also
return more clones, as any sequencing error in the window is not corrected.
The special -w all
option takes all the read as the windows, completely disabling
the clustering by windows and generally returning more clones. This should only be used on
datasets where reads of the same clone do have exactly the same length, or in situations
in which one want to study very precisely the clonality, tracking all mutations along the read.
Setting -w
to lower values than 50 may analyze a few more reads, depending
on the read length of your data, but may in some cases falsely cluster reads from
different clones.
For VJ recombinations, the -w 40
option is usually safe, and -w 30
can also be tested.
Setting -w
to lower values is not recommended.
When the read is too short too extract the requested length, the window can be shifted
(at most 10 bp) or shrinkened (down until 30bp) by increments of 5bp. Such reads
are counted in SEG changed w
and the corresponding clones are output with the W50
warning.
The -e
option sets the maximal e-value accepted for analyzing a sequence.
It is an upper bound on the number of designated sequences found by chance by vidjil-algo.
The e-value computation takes into account both the number of locus searched for
and, for the defaut -c clones
command, the number of reads in the input sequence.
The default value is 1.0, but values such as 1000, 1e-3 or even less can be used
to have a more or less permissive detection and designation.
The threshold can be disabled with -e all
.
The advanced --e-value-kmer
option sets the e-value for the seed-based heuristic.
It is an upper bound on the number of expected windows found by chance.
The default value is the same than value than the -e
.
The advanced --trim
option sets the maximal number of nucleotides that will be indexed in
V genes (the 3' end) or in J genes (the 5' end). This reduces the load of the
indexes, giving more precise window estimation and e-value computation.
However giving a --trim
may also reduce the probability of seeing a heavily
trimmed or mutated V gene.
The default is --trim 0
.
Thresholds on clone output
The following options control how many clones are output and analyzed.
Input
-x, --first-reads INT maximal number of reads to process ('all': no limit, default), only first reads
-X, --sampled-reads INT maximal number of reads to process ('all': no limit, default), sampled reads
Limits to report and to analyze clones (second pass)
-r, --min-reads INT=5 minimal number of reads supporting a clone
--min-ratio FLOAT=0 minimal percentage of reads supporting a clone
--max-clones INT maximal number of output clones ('all': no maximum, default)
-y, --max-consensus INT=100 maximal number of clones computed with a consensus sequence ('all': no limit)
-z, --max-designations INT=100
maximal number of clones to be analyzed with a full V(D)J designation ('all': no limit, do not use)
--all reports and analyzes all clones
(--min-reads 1 --min-ratio 0 --max-clones all --max-consensus all --max-designations all),
to be used only on small datasets (for example --all -X 1000)
The -r/--ratio
options are strong thresholds: if a clone does not have
the requested number of reads, the clone is discarded (except when
using --label
, see below).
The default -r 5
option is meant to only output clones that
have a significant read support. You should use -r 1
if you
want to detect all clones starting from the first read (especially for
MRD detection).
The --max-clones
option limits the number of output clones, even without consensus sequences.
The --max-consensus
option limits the number of clones for which a consensus
sequence is computed. Usually you do not need to have more
consensus (see below), but you can safely put --max-consensus all
if you want
to compute all consensus sequences.
The --max-designations
option limits the number of clones that are fully analyzed,
with their V(D)J designation and possibly a CDR3 detection,
in particular to enable the web application
to display the clones on the grid (otherwise they are displayed on the
'?/?' axis).
These V(D)J designations are obtained by full comparison (dynamic programming) with all germline sequences. Note that these designations are relatively slow to compute, especially for the IGH locus. However, they are not at the core of the Vidjil clone clustering method (which relies only on the 'window', see above). To check the quality of these designations, the automated test suite include sequences with manually curated V(D)J designations.
If you want to analyze more clones, you should use --max-designations 200
or
--max-designations 500
. It is not recommended to use larger values: outputting more
than 500 clones is often not useful since they can not be visualized easily
in the web application, and takes more computation time.
Note that even if a clone is not in the top 100 (or 200, or 500) but
still passes the -r
, --ratio
options, it is still reported in both the .vidjil
and .vdj.fa
files. If the clone is at some MRD point in the top 100 (or 200, or 500),
it will be fully analyzed by this other point (and then
collected by the fuse.py
script, using consensus sequences computed at this
other point, and then, on the web application, correctly displayed on the grid).
Thus is advised to leave the default --max-designations 100
option
for the majority of uses.
The --all
option disables all these thresholds. This option can be
used for test and debug purposes or on small datasets.
It produces large file and takes more time.
The --analysis-filter
advanced option speeds up the full analysis by a pre-processing step,
again based on k-mers, to select a subset of the V germline genes to be compared to the read.
The option gives the typical size of this subset (it can be larger when several V germlines
genes are very similar, or smaller when there are not enough V germline genes).
The default --analysis-filter 3
is generally safe.
Setting --analysis-filter all
removes this pre-processing step, running a full dynamic programming
with all germline sequences that is much slower.
Sequences of interest
Vidjil-algo allows to indicate that specific sequences should be followed and output,
even if those sequences are 'rare' (below the -r/--ratio
thresholds).
Such sequences can be provided either with --label <sequence>
, or with --label-file <file>
.
The file given by --label-file
should have one sequence by line, as in the following example:
GAGAGATGGACGGGATACGTAAAACGACATATGGTTCGGGGTTTGGTGCT my-clone-1
GAGAGATGGACGGAATACGTTAAACGACATATGGTTCGGGGTATGGTGCT my-clone-2 foo
Sequences and labels must be separated by one space. The first column of the file is the sequence to be followed while the remaining columns consist of the sequence's label. In Vidjil-algo output, the labels are output alongside their sequences.
A sequence given --label <sequence>
or with --label-file <file>
can be exactly the size
of the window (-w
, that is 50 by default). In this case, it is guaranteed that
such a window will be output if it is detected in the reads.
More generally, when the provided sequence differs in length with the windows
we will keep any windows that contain the sequence of interest or, conversely,
we will keep any window that is contained in the sequence of interest.
This filtering will work as expected when the provided sequence overlaps
(at least partially) the CDR3 or its close neighborhood,
but will not work when the sequence is far of the CDR3 (except when
using large -w
values or -w all
).
With the --label-filter
option, only the windows related to the given sequences are kept.
This allows to quickly filter a set of reads, looking for a known sequence or window,
with the --grep-reads <sequence>
preset, equivalent to
--out-reads --label-filter --label <sequence>
:
All the reads with the windows related to the sequence will be extracted
to files such as out/seq/clone.fa-1
.
Further clone analysis: V(D)J designation, CDR3 detection
Note that such sequences must have been detected as a V(D)J (or V(D)J-like) recombination
in the first pass: the --label
, -label-file
, or --label-filter
options can not
detect a recombination that was not detected when removing all the thresholds with --all
.
To increase the sensitivity, see above the --e-value
option, or,
to look for non-recombined sequences, see above the experimental 1
sequence analysis.
Clone analysis (second pass)
-d, --several-D try to detect several D (experimental)
-3, --cdr3 CDR3/JUNCTION detection (requires gapped V/J germlines)
The -3
option launches a CDR3/JUNCTION detection based on the position
of Cys104 and Phe118/Trp118 amino acids. This detection relies on alignment
with gapped V and J sequences, as for instance, for V genes, IMGT/GENE-DB sequences,
as provided by make germline
.
The CDR3/JUNCTION detection won't work with custom non-gapped V/J repertoires.
CDR3 are reported as productive when they come from an in-frame recombination and when the sequence does not contain any in-frame stop codons. Note that some other software only consider stop codons in the CDR3, and may thus under-estimate non-productivity. When the sequence is long enough to start before the start of the V gene or to end after the end of the J gene, vidjil-algo do not consider these intronic sequences in the productivity estimation.
The advanced --analysis-cost
option sets the parameters used in the comparisons between
the clone sequence and the V(D)J germline genes. The default values should work.
The e-value set by -e
is also applied to the V/J designation.
The -E
option further sets the e-value for the detection of D segments.
Further clustering (experimental)
The following options are experimental and have no consequences on the .vdj.fa
file,
nor on the standard output. They instead add a clusters
sections in the .vidjil
file
that will be visualized in the web application.
Any such clustering should be avoided when one wants to precisely study hypermutations.
The web application provides other options to inspect clones and cluster them.
The --cluster-epsilon
option triggers an automatic clustering using the
DBSCAN algorithm (Ester and al., 1996).
Using --cluster-epsilon 5
usually clusters reads within a distance of 1 mismatch (default score
being +1 for a match and -4 for a mismatch). With that option, more distant reads will also
be clustered as soon there are more than 10 reads within the distance threshold.
This behaviour can be controlled with the -cluster-N
option.
Setting --cluster-epsilon 10
, possibly with --cluster-N 5
or --cluster-N 1
will perform more aggressive clustering and is generally not advised.
The --cluster-forced-edges
option allows to specify a file for manually clustering two windows
considered as similar. Such a file may be automatically produced by vidjil-algo
(out/edges
), depending on the option provided. Only the two first columns
(separed by one space) are important to vidjil-algo, they only consist of the
two windows that must be clustered.
Output
Main output files
The default output of Vidjil-algo (with the default -c clones
command) are the two following files:
-
The
.vidjil
file is the main output file, containing the most information. The file is in a.json
format, its specification is detailed in vidjil-format. It describes the clones, with the windows and their count, the consensus sequences (--max-consensus
), the detailed V(D)J and CDR3 designation (--max-designations
, see warning below), and possibly the results of the further clustering.The web application takes this
.vidjil
file (possibly merged withfuse.py
) for the visualization and analysis of clones and their tracking along different samples (for example time points in a MRD setup or in a immunological study). Please see the web application user manual for more information. -
The
.tsv
file is the AIRR output, for compatibility with other software using the same format. See below for details.
By default, these output files are named
out/basename.vidjil
and out/basename.tsv
, where:
out
is the directory where all the outputs are stored (can be changed with the--dir
option).basename
is the basename of the input.fasta/.fastq
file (can be overriden with the--base
option)
With the --gz
option, both files are output
as compressed .vidjil.gz
and .tsv.gz
files.
Vidjil-algo also outputs the first 50 clones on the standard output.
More data can be printed on the standard output with the -v
option.
Auxiliary output files
.vdj.fa
With the --out-vdjfa
option, a .vdj.fa
file is created (or, with --gz
, a .vdj.fa.gz
file).
This is a FASTA file for further processing by other bioinformatics tools.
Even if it is advised to rather use the full information in the .vijdil
file,
the .vdj.fa
is a convenient way to have sequences of clones for further processing.
These sequences are at least the windows (and their count in the headers) or
the consensus sequences (--max-consensus
) when they have been computed.
The headers are described below, but the format of the headers is deprecated
and will not be enforced in future releases.
Some other informations such as the further clustering are not output in this file.
The .vdj.fa
output enables to use Vidjil-algo as a filtering tool,
shrinking a large read set into a manageable number of (pre-)clones
that will be deeply analyzed and possibly further clustered by
other software.
.windows.fa
The out/basename.windows.fa
file contains the list of windows, with number of occurrences:
>8--window--1
TATTACTGTACCCGGGAGGAACAATATAGCAGCTGGTACTTTGACTTCTG
>5--window--2
CGAGAGGTTACTATGATAGTAGTGGTTATTACGGGGTAGGGCAGTACTAC
ATAGTAGTGGTTATTACGGGGTAGGGCAGTACTACTACTACTACATGGAC
(...)
Windows of size 50 (modifiable by -w
) have been extracted.
The first window has 8 occurrences, the second window has 5 occurrences.
seq/clone.fa-*
With the --out-clone-files
option, one out/seq/clone.fa-*
file is created for each clone.
It contains the detailed analysis by clone, with
the window, the consensus sequence, as well as with the most similar V, (D) and J germline genes:
>clone-001--IGH--0000008--0.0608%--window
TATTACTGTACCCGGGAGGAACAATATAGCAGCTGGTACTTTGACTTCTG
>clone-001--IGH--0000008--0.0608%--lcl|FLN1FA001CPAUQ.1|-[105,232]-#2 - 128 bp (55% of 232.0 bp) + VDJ 0 54 73 84 85 127 IGHV3-23*05 6/ACCCGGGAGGAACAATAT/9 IGHD6-13*01 0//5 IGHJ4*02 IGH SEG_+ 1.946653e-19 1.352882e-19/5.937712e-20
GCTGTACCTGCAAATGAACAGCCTGCGAGCCGAGGACACGGCCACCTATTACTGT
ACCCGGGAGGAACAATATAGCAGCTGGTAC
TTTGACTTCTGGGGCCAGGGGATCCTGGTCACCGTCTCCTCAG
>IGHV3-23*05
GAGGTGCAGCTGTTGGAGTCTGGGGGAGGCTTGGTACAGCCTGGGGGGTCCCTGAGACTCTCCTGTGCAGCCTCTGGATTCACCTTTAGCAGCTATGCCATGAGCTGGGTCCGCCAGGCTCCAGGGAAGGGGCTGGAGTGGGTCTCAGCTATTTATAGCAGTGGTAGTAGCACATACTATGCAGACTCCGTGAAGGGCCGGTTCACCATCTCCAGAGACAATTCCAAGAACACGCTGTATCTGCAAATGAACAGCCTGAGAGCCGAGGACACGGCCGTATATTACTGTGCGAAA
>IGHD6-13*01
GGGTATAGCAGCAGCTGGTAC
>IGHJ4*02
ACTACTTTGACTACTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAG
The --out-reads
debug option further output in each out/seq/clone.fa-*
files the full list of reads belonging to this clone.
The --out-reads
option produces large files, and is not recommended in general cases.
Diversity measures
Several diversity indices are reported, both on the standard output and in the .vidjil
file:
- H (
index_H_entropy
): Shannon's diversity - E (
index_E_equitability
): Shannon's equitability - Ds (
index_Ds_diversity
): Simpson's diversity
E ans Ds values are between 0 (no diversity, one clone clusters all analyzed reads) and 1 (full diversity, each analyzed read belongs to a different clone). These values are now computed on the windows, before any further clustering. PCR and sequencing errors can thus lead to slightly over-estimate the diversity.
Reads without detected recombinations
Vidjil-algo outputs details statistics on the reads where no recombination was detected Basically, an unanalyzed read is a read where Vidjil-algo cannot identify a window at the junction of V and J genes. To properly analyze a read, Vijdil-algo needs that the sequence spans enough V region and J region (or, more generally, 5' region and 3' regions when looking for incomplete or unusual recombinations). The following causes are reported:
UNSEG too short |
Reads are too short, shorter than the seed (by default between 9 and 13 bp). |
UNSEG strand |
The strand is mixed in the read, with some similarities both with the + and the - strand. |
UNSEG too few V/J |
No information has been found on the read: There are not enough similarities neither with a V gene or a J gene. |
UNSEG only V/5 |
Relevant similarities have been found with some V, but none or not enough with any J. |
UNSEG only J/3 |
Relevant similarities have been found with some J, but none or not enough with any V. |
UNSEG ambiguous |
vidjil-algo finds some V and J similarities mixed together which makes the situation ambiguous and hardly solvable. |
UNSEG too short w |
The junction can be identified but the read is too short so that vidjil-algo could extract the window (by default 50bp). It often means the junction is very close from one end of the read. |
Some datasets may give reads with many low UNSEG too few
reads:
-
UNSEG too few V/J
usually happens when reads share almost nothing with the V(D)J region. This is expected when the PCR or capture-based approach included other regions, such as in whole RNA-seq. -
UNSEG only V/5
andUNSEG only J/3
happen when reads do not span enough the junction zone. Vidjil-algo detects a “window” including the CDR3. By default this window is 50bp long, so the read needs be that long centered on the junction.
See the user manual for information on the biological or sequencing causes that can lead to few analyzed reads.
Filtering reads
Detailed output per read (generally not recommended, large files, but may be used for filtering, as in -uu -X 1000)
-U, --out-detected output reads with detected recombinations (in .detected.vdj.fa file)
-u, --out-undetected
-u output undetected reads, gathered by cause, except for very short and 'too few V/J' reads (in *.fa files)
-uu output undetected reads, gathered by cause, all reads (in *.fa files) (use only for debug)
-uuu output undetected reads, all reads, including a .undetected.vdj.fa file (use only for debug)
--out-reads output all reads by clones (clone.fa-*), to be used only on small datasets
-K, --out-affects output detailed k-mer affectation for each read (in .affects file) (use only for debug, for example -KX 100)
It is possible to extract all reads with or without detected recombinations,
possibly to give them to other software.
Runing Vidjil-algo with -U
gives a file out/basename.detected.vdj.fa
, with all detected reads.
On datasets generated with rather specific V(D)J primers, this is generally not recommended, as it may generate a large file.
However, the -U
option is very useful for whole RNA-Seq or capture datasets that contain few reads with V(D)J recombinations.
Moreover -U
only uses the ultra-fast first passs analysis, based on k-mer heuristics.
Similarly, options are available to get the non analyzed reads:
-
-u
gives a set of filesout/basename.UNSEG_*
, with not detected reads gathered by cause. It outputs only reads sharing significantly sequences with V/J germline genes or with some ambiguity: it may be interesting to further study RNA-Seq datasets. -
-uu
gives the same set of files, including all not detected reads (includingUNSEG too short
andUNSEG too few V/J
), and-uuu
further outputs all these reads in a fileout/basename.undetected.vdj.fa
.
Again, as these options may generate large files, they are generally not recommended.
However, they are very useful in some situations, especially to understand
why some dataset gives low detection rate.
For example -uu -X 1000
splits the not detected reads from the 1000 first reads.
AIRR .tsv output
Since version 2018.10, vidjil-algo supports the AIRR format.
We export all required fields, some optional fields, as also some custom fields (+).
We also propose in fuse.py a way to convert AIRR format to the .vidjil
format.
Note that Vidjil-algo is designed to efficiently gather reads from large datasets into clones.
By default (-c clones
), we thus report in the AIRR format clones.
See also What is a clone ?.
Using -c designations
trigger a separate analysis for each read, but this is usually not advised for large datasets.
Name | Type | AIRR 1.2 Description vidjil-algo implementation |
---|---|---|
locus | string | Gene locus (chain type). For example, IGH , IGK , IGL , TRA , TRB , TRD , or TRG .Vidjil-algo outputs all these loci. Moreover, the incomplete recombinations analyzed by vidjil-algo are reported as IGH+ , IGK+ , TRA+D , TRB+ , TRD+ , and xxx for unexpected recombinations. See |
duplicate_count | number | Number of reads contributing to the (UMI) consensus for this sequence. For example, the sum of the number of reads for all UMIs that contribute to the query sequence. Number of reads gathered in the clone. |
sequence_id | string | Unique query sequence identifier within the file. Most often this will be the input sequence header or a substring thereof, but may also be a custom identifier defined by the tool in cases where query sequences have been combined in some fashion prior to alignment. This identifier is the (50 bp by default) window extacted around the junction. |
clone_id | string | Clonal cluster assignment for the query sequence. This identifier is again the (50 bp by default) window extacted around the junction. |
warnings (+) | string | Warnings associated to this clone. See http://gitlab.vidjil.org/blob/dev/doc/warnings.md. |
sequence | string | The query nucleotide sequence. Usually, this is the unmodified input sequence, which may be reverse complemented if necessary. In some cases, this field may contain consensus sequences or other types of collapsed input sequences if these steps are performed prior to alignment. This contains the consensus/representative sequence of each clone. |
rev_comp | boolean | True if the alignment is on the opposite strand (reverse complemented) with respect to the query sequence. If True then all output data, such as alignment coordinates and sequences, are based on the reverse complement of 'sequence'. Set to null, as vidjil-algo gather reads from both strands in clones |
v_call, d_call, j_call | string | V/D/J gene with allele. For example, IGHV4-59*01. implemented. In the case of uncomplete/unexpected recombinations (locus with a + ), we still use v/d/j_call . Note that this value can be null on clones beyond the --max-designations option. |
v_sequence_start, v_sequence_end d_sequence_start, d_sequence_end j_sequence_start, j_sequence_end |
number | Start/end position of the V/D/J genes and of the CDR3 in the query sequence (1-based closed interval). implemented |
v_support, j_support | number | V/J gene alignment E-value, p-value, likelihood. implemented |
junction | string | Junction region nucleotide sequence, where the junction is defined as the CDR3 plus the two flanking conserved codons. null |
junction_aa | string | Junction region amino acid sequence. implemented |
cdr3_aa | string | Amino acid translation of the cdr3 field. implemented |
cdr3_sequence_start, cdr3_sequence_end | number | Start/end position of the CDR3 in the query sequence (1-based closed interval). implemented |
productive | boolean | True if the V(D)J sequence is predicted to be productive. true, false, or null when no CDR3 has been detected |
vj_in_frame | boolean | True if the V and J gene alignments are in-frame. true, false, or null when no CDR3 has been detected |
stop_codon | boolean | True if the aligned sequence contains a stop codon. true, false, or null when vj_in_frame is false |
sequence_alignment | string | Aligned portion of query sequence, including any indel corrections or numbering spacers, such as IMGT-gaps. Typically, this will include only the V(D)J region, but that is not a requirement. null |
germline_alignment | string | Assembled, aligned, fully length inferred germline sequence spanning the same region as the sequence_alignment field (typically the V(D)J region) and including the same set of corrections and spacers (if any). null |
v_cigar, d_cigar, j_cigar | string | CIGAR strings for the V/D/J gene null. |
Currently, we do not output alignment strings. Our implementation of .tsv may evolve in future versions. Contact us if a particular feature does interest you.
Headers in the .vdj.fa files (deprecated)
The .vdj.fa
format is compatible with the FASTA format.
The FASTA header of each sequence gives some details on the V(D)J recombinations.
The format of these headers is described below, but is considered as deprecated and may be removed in future releases in Q3 2021.
For post-processing tools needing some of that information, it is thus not recommended to parse these headers,
but rather to use either the .vidjil
file that contains more information in a structured way, or the AIRR .tsv
output.
In a .vdj.fa
format, a line starting with a > is of the following form:
>name + VDJ startV endV startD endD startJ endJ Vgene delV/N1/delD5' Dgene delD3'/N2/delJ Jgene comments
name sequence name (include the number of occurrences in the read set and possibly other information)
+ strand on which the sequence is mapped
VDJ type of designation (can be "VJ", "VDJ", "VDDJ", "53"...
or shorter tags such as "V" for incomplete sequences).
The following lines are for VDJ recombinations:
startV endV start and end position of the V gene in the sequence (start at 1)
startD endD ... of the D gene ...
startJ endJ ... of the J gene ...
Vgene name of the V gene
delV number of deletions at the end (3') of the V
N1 nucleotide sequence inserted between the V and the D
delD5' number of deletions at the start (5') of the D
Dgene name of the D gene being rearranged
delD3' number of deletions at the end (3') of the D
N2 nucleotide sequence inserted between the D and the J
delJ number of deletions at the start (5') of the J
Jgene name of the J gene being rearranged
comments optional comments. In Vidjil, the following comments are now used:
- "seed" when this comes for the first pass (.detected.vdj.fa). See the warning above.
- "!ov x" when there is an overlap of x bases between last V seed and first J seed
- the name of the locus (TRA, TRB, TRG, TRD, IGH, IGL, IGK, possibly followed
by a + for incomplete/unusual recombinations)
Following such a line, the nucleotide sequence may be given, giving in this case a valid FASTA file.
For VJ recombinations the output is similar, the fields that are not applicable being removed:
>name + VJ startV endV startJ endJ Vgene delV/N1/delJ Jgene comments
In the .detected.vdj.fa
file, the start/end positions of V and J genes are only an estimation,
get from the k-mer heuristics, as the center of the window may be shifted up to 15 bases from the actual center.
In the final .vdj.fa
file, these values are the correct ones computed after dynamic programming comparison
with germline genes.
Examples of use
Basic usage
On PCR-based datasets with primers in the V(D)J regions (such as EuroClonality-NGS or EuroClonality/BIOMED-2 primer sets), almost all of the reads are expected to be actual V(D)J recombinations. On the other side, typical whole RNA-Seq or capture datasets usually have only a (very) small portion of recombined sequences. The following commands work in both cases, detecting the locus for each recombined read, clustering such reads into clones, and further analyzing the clones.
./vidjil-algo -c clones -g germline/homo-sapiens.g -2 -3 -r 1 demo/Demo-X5.fa
# Detect the locus for each read, cluster and report clones starting from the first read (-r 1).
# including unexpected recombinations (-2). Assign the V(D)J genes and try to detect the CDR3s (-3).
# Demo-X5 is a collection of sequences on all human locus, including some incomplete or unusual recombinations:
# IGH (VDJ, DJ), IGK (VJ, V-KDE, Intron-KDE), IGL, TRA, TRB (VJ, DJ), TRG and TRD (VDDJ, Dd2-Dd3, Vd-Ja).
./vidjil-algo -g germline/homo-sapiens.g:IGH -3 demo/Stanford_S22.fasta
# Cluster the reads and report the clones, based on windows overlapping IGH CDR3s.
# Assign the V(D)J genes and try to detect the CDR3 of each clone.
# Main output files are both out/Stanford_S22.vidjil and out/Stanford_S22.tsv.
# Summary of clones is available on stdout.
./vidjil-algo -g germline/homo-sapiens.g -2 -3 -d demo/Stanford_S22.fasta
# Detects for each read the best locus, including an analysis of incomplete/unusual and unexpected recombinations
# Cluster the reads into clones, again based on windows overlapping the detected CDR3s.
# Assign the VDJ genes (including multiple D) and try to detect the CDR3 of each clone.
# Main output files are both out/reads.vidjil and out/reads.tsv.
# Summary of clones is available on stdout.
Sorting reads from whole RNA-Seq or capture datasets
./vidjil-algo -g germline/homo-sapiens.g -2 -U demo/Stanford_S22.fasta
# Detects for each read the best locus, including an analysis of incomplete/unusual and unexpected recombinations
# Cluster the reads into clones, again based on windows overlapping the detected CDR3s.
# Assign the VDJ genes and try to detect the CDR3 of each clone.
# The out/reads.detected.vdj.fa include all reads where a V(D)J recombination was found
Typical whole RNA-Seq or capture datasets may be huge (several GB) but with only a (very) small portion of recombined sequences.
Using Vidjil with -U
will create a out/reads.detected.vdj.fa
file
that includes all reads where a V(D)J recombination (or an unexpected recombination, with -2
) was found.
This file will be relatively small (a few kB or MB) and can be taken again as an input for Vidjil-algo or for other programs.
Advanced usage
An experimental further clustering can be triggered with --cluster-epsilon
.
./vidjil-algo -c clones -g germline/homo-sapiens.g -r 1 --cluster-epsilon 5 -x 10000 demo/LIL-L4.fastq.gz
# Extracts the windows with at least 1 read each (-r 1, the default being -r 5)
# on the first 10,000 reads, then cluster them into clones
# with a second clustering step at distance five (--cluster-epsilon 5)
# The result of this second is in the .vidjil file ('clusters')
# and can been seen and edited in the web application.
The V(D)J designation is usually run at the end of the clones detection (default command -c clones
,
on a number of clones limited by the --max-designations
option).
It is also possible to explicitly require V(D)J designation for each read (-c designations
,
no clone clustering, not recommended for large datasets)
./vidjil-algo -c designations -g germline/homo-sapiens.g -2 -3 -d -x 50 demo/Stanford_S22.fasta
# Detailed V(D)J designation, including multiple D, and CDR3 detection on the first 50 reads, without clone clustering
# (this is not as efficient as '-c clones', no clustering)
The command -c germlines
outputs statistics on k-mers.
./vidjil-algo -c germlines -g germline/homo-sapiens.g demo/Stanford_S22.fasta
# Output statistics on the number of occurrences of k-mers of the different germlines
Following clones in several samples
The goal of many immune repertoire sequencing (RepSeq) studies is to follow clones with V(D)J recombinations across several samples. This can be in a minimal residual disease (MRD) setup, tracking the clones found at the diagnosis in follow-up points, or more generally in any immunological study comparing samples from the same person or from different people.
The .vidjil
file output by vidjil-algo
keeps track of some clones in one sample,
limited by --max-clones
.
By default all the clones of the sample are kept (--max-clones all
),
even if the V(D)J designation is computed only for some of them.
The tools/fuse.py
script, as documented here,
merge several .vidjil
files into a single one that can then be fed to the web client:
python tools/fuse.py --output out.vidjil --top 100 sample1.vidjil sample2.vidjil sample3.vidjil
As the --top
value is equal or below the default --max-designations 100
, it means that every clone in the
"merged" file will be fully analyzed with a V(D)J designation.
Thus is advised to leave, in vdijil-algo
the default --max-clones all --max-designations 100
options
for the majority of uses.