Vidjil APIs⚓︎
These APIs were first released in 2022, and continue to improve as of 2023. Please contact us for additional details.
Vidjil server API⚓︎
This API and the Python Vidjil library allows to interact with a Vidjil server, notably: - to automate parts of your workflows (patient/sample/run creation, data upload, analysis lauch), - and to perform batch analysis of data.
Code examples can be found in tools/api_demo.py
, and first steps are below.
Warning
When interacting with a production server (such as Vidjil public servers), please be very careful on requests you send, espacially when updating or deleting data. Do not spam the Vidjil public servers.
First steps⚓︎
Install required libraries
pip install requests bs4 tabulate requests-toolbelt urllib3
Download SSL certificate of target Vidjil server.
SERVERNAME=localhost # adapt it to your need
echo -n | openssl s_client -connect $SERVERNAME:443 | sed -ne '/-BEGIN CERTIFICATE-/,/-END CERTIFICATE-/p' > ./cert_$SERVERNAME.pem
You can then use the API.
from api_vidjil import Vidjil
ssl_pem="path/cert_SERVERNAME.pem"
vidjil = Vidjil(server_url, ssl=ssl_pem)
vidjil.login(user, password)
A confirmation is displayed with your user name.
You can now interact with the server to get some data, for example of the demo patient Lil-l3
.
sample_set_id = 25736 # Demo lil L3
config_id = 25 # multi+inc+xxx
### Get a set from server by his id and set type
sets_demo = vidjil.getSetById(sample_set_id, vidjil.PATIENT)
vidjil.infoSets("Set %s" % sample_set_id, sets_demo, set_type=vidjil.PATIENT, verbose=True)
Further use⚓︎
The api_demo.py
has more examples, especially in the demoWriteRunOnServer
function.
Vidjil-algo analyze API⚓︎
This API runs vidjil-algo
with the default parameters to compute V(D)J assignations on DNA sequences.
It takes a limited number of Fasta sequence (up to 10)
and returns a .vidjil file with the analysis of these sequences, such as here:
import requests
import json
# Subset of sequences from demo/Demo-X5.fa
sequences = '''>seq1
CCCAGGCTCCTCATCTATGATGCATCCACCAGGGCCACTAGCATCCCAGCCAGGTTCAGTGGCAGTGGGTCTGGGACAGACTTCACTCTCACCATCAGCAGCCTGCAGCCTGAAGATTTTGCAGTTTATTACTGTCAGCAGGATTATAACTTACCTCGTGGAGGCAGCCCAGGGCGACTCCTCATGAGTCTGCAGCTGCATTTTTGCCATATCCACTATTTGGAGTCTGACCTCCCTAGGAAGCCTCCCTGCTCCCTAGGACAACCTGCTCTGACCTCTGAGG
>seq2
AACGGTGTAGTGGATGATTCACAGTTGCCTAAGGATCGATTTTCTGCAGAGAGGCTCAAAGGAGTAGACTCCACTCTCAAGATCCAGCCTGCAAAGCTTGAGGACTCGGCCGTGTATCTCTGTGCCAGCAGCTTAGGTCCCTCGTACGAGCAGTACTTCGGGCCGGGCACCAGGCTC
>seq3
AGCGGGTGGTGATGGCAAAGTGCCAAGGAAAGGGAAAAAGGAAGAAGAGGGTTTTTATACTGATGTGTTTCATTGTGCCTTCCTATGGCAGTGCTACAAAACCTACAGAGACCTGTACAAAAACTGCAGGGGCAAAAGTGCCATTTCCCTGGGATATCCTCACCCTGGGTCCCATGCCTCAGGAGACAAACACAGCAAGCAGCTTCCCTC
'''
# POST url of the server
url_post = "https://db.vidjil.org/vidjil/segmenter"
r = requests.post(url_post, data={'sequences': sequences})
print(r.status_code) # Should be 200 if everything is Ok
vidjil = r.json() # Convert raw text data into json
print(f"Vidjil-algo found {len(vidjil['clones'])} clonotypes.")
for clone in vidjil["clones"]:
print( f"\t{clone['germline']}; {clone['name']};")
To perform analyses on more data from the command line, please install and use vidjil-algo.