Skip to content

The Vidjil team (Mathieu, Mikaël, Aurélien, Florian, Marc, Tatiana and Rayan)

  Vidjil -- High-throughput Analysis of V(D)J Immune Repertoire -- [[https://www.vidjil.org]]
  Copyright (C) 2011-2025 by Bonsai bioinformatics
  at CRIStAL (UMR CNRS 9189, Université Lille) and Inria Lille
  and VidjilNet consortium.
  contact@vidjil.org

This is the help of vidjil-algo, for command-line usage. This manual can be browsed online:

Other documentations for life scientists, bioinformaticians, server administrators, and developers can be found at https://www.vidjil.org/doc/.

About⚓︎

V(D)J recombinations in lymphocytes are essential for immunological diversity. They are also useful markers of pathologies, and in leukemia, are used to quantify the minimal residual disease during patient follow-up. With adapted library preparation and sequencing, high-throughput sequencing (NGS/HTS) now enables the deep sequencing of a lymphoid population with dedicated sequencing methods and software, called either Rep-Seq or AIRR-Seq.

Vidjil-algo processes high-throughput sequencing data to extract V(D)J junctions and gather them into clones. Vidjil-algo starts from a set of reads and detects "windows" overlapping the actual CDR3. This is based on an fast and reliable seed-based heuristic and allows to output all sequenced clones. The analysis is extremely fast because, in the first phase, no alignment is performed with database germline sequences. At the end, only the consensus sequences of each clone have to be analyzed. Vidjil-algo can also cluster similar clones, or leave this to the user after a manual review in the web application.

The method is described in the following references:

Vidjil-algo is open-source, released under GNU GPLv3+ license.

Requirements and installation⚓︎

Performance⚓︎

To run with the default options on a 1GB .fastq file issue from amplicon protocol, vidjil-algo typically uses approximately 1.2GB of RAM and will take approx. 5+ minutes on a standard core at a few GHz. The actual performance mainly depends on the size of the input file, the number of expected clonotype, the number of processed germlines, and on some parameters (eg: A file of rnaseq with few clonotype will take less memory than a file with polyclonal repertoire from amplicon protocol).

Anyway, to process occasional requests from a single user with a few samples, a laptop or a desktop computer with any standard multi-core processor and 2GB RAM will be enough. Requirements for running a server handling more regular requests are detailed in server.md.

Supported platforms⚓︎

Vidjil-algo is systematically tested with the following compilers :

  • gcc/g++ 7.5, 8.4, 9.3, 10.1, 11
  • clang 6.0, 7.0, 11.0, 12.0

We aim to support all GCC/Clang compilers whose major versions were first released in the last 5 years. These compilers are available on recent OS X and on the following Linux distributions:

  • CentOS 8, CentOS Stream
  • Debian Buster 10, Bullseye 11, Bookworm 12, Trixie 13
  • FreeBSD 12.2, 12.3, 13.0, 14.0
  • Ubuntu 18.04 LTS, 20.04 LTS, 24.04 LTS

Vidjil-algo is developed with continuous integration using systematic unit and functional testing. The development team internally uses Gitlab CI for that, and the tested compilers are run through Docker containers described in .gitlab-ci-compilers.yml.

Installation (from source)⚓︎

Build requirements⚓︎

To compile Vidjil-algo, make sure:

  • to be on a POSIX system ;
  • to have a C++11 compiler (as g++ 7.5 or above, or clang 6.0 or above).
  • to have the zlib installed (zlib1g-dev package under Debian/Ubuntu, zlib-devel package under Fedora/CentOS).
  • to have GNU make (gmake under FreeBSD).

Download⚓︎

These instructions target stable releases of vidjil-algo, as downloaded from https://www.vidjil.org/releases.

curl -O https://www.vidjil.org/releases/vidjil-algo-latest.tar.gz
tar xvfz vidjil-algo-latest.tar.gz
cd vidjil-algo-*

Note that development code is found at https://gitlab.inria.fr/vidjil/vidjil/, in the algo directory. and compiling and running vidjil-algo on the development code can involve slightly different commands than below, including replacing src by algo.

Compiling⚓︎

Running make from the extracted archive should be enough to install vidjil-algo with germline and demo files. It runs the three following make commands.

make germline
   # get IMGT germline databases (IMGT/GENE-DB) -- you have to agree to IMGT license: 
   # academic research only, provided that it is referred to IMGT®,
   # and cited as "IMGT®, the international ImMunoGeneTics information system® 
   # https://www.imgt.org (founder and director: Marie-Paule Lefranc, Montpellier, France). 
   # Lefranc, M.-P., IMGT®, the international ImMunoGeneTics database,
   # Nucl. Acids Res., 29, 207-209 (2001). PMID: 11125093


make -C src              # build vijil-algo from the sources (see the requirements,
                         # another option is: wget https://www.vidjil.org/releases/vidjil-algo-latest_x86_64 -O vidjil-algo
                         # to download a static binary (built for x86_64 architectures)

make demo                # download demo files (S22 and L4, see demo/get-sequences)

./vidjil-algo -h         # display help/usage

On some older systems you may need to replace the make commands with:

make LDFLAGS='-stdlib=libc++'  ### OS X Mavericks
make MAKE=gmake CXXFLAGS="-std=c++11 -O2 Wall -D_GLIBCXX_USE_C99 -Wl,-rpath=/usr/local/lib/gcc49"   ### old FreeBSD

WASM⚓︎

When compiling for WASM, you should compile using:

emmake make -j 10 wasm

This will generate three files: vidjil-algo.data, vidjil-algo.wasm and vidjil-algo.js.

Self-tests (optional)⚓︎

You can run the tests with the following commands:

make -C src/tests/data
   # get IGH recombinations from a single individual, as described in:
   # Boyd, S. D., and al. Individual variation in the germline Ig gene
   # repertoire inferred from variable region gene rearrangements. J
   # Immunol, 184(12), 6986–92.

make -C src test                # run self-tests (can take 5 to 60 minutes)

Installation (static binaries, x86_64 platforms)⚓︎

Run the following commands:

curl https://www.vidjil.org/releases/vidjil-algo-latest_x86_64 -o vidjil-algo
chmod 755 vidjil-algo
curl -O https://gitlab.inria.fr/vidjil/vidjil/-/raw/master/doc/vidjil-algo.md

### Germlines
mkdir germline
cd germline
curl -O https://gitlab.inria.fr/vidjil/vidjil/-/raw/master/germline/homo-sapiens.g
curl -O https://gitlab.inria.fr/vidjil/vidjil/-/raw/master/germline/germline_id
curl https://gitlab.inria.fr/vidjil/vidjil/-/raw/master/germline/get-saved-germline | sh
cd ..

### Demo sequences (optional)
mkdir demo
cd demo
curl -O https://gitlab.inria.fr/vidjil/vidjil/-/raw/master/demo/Demo-X5.fa
curl https://gitlab.inria.fr/vidjil/vidjil/-/raw/master/demo/get-sequences | sh
cd ..

./vidjil-algo -h

Input and parameters⚓︎

The -h and -H help options provide the list of parameters that can be used. We detail here the options of the main -c clones command.

The default options are very conservative (large window, no further automatic clusterization, see below), leaving the user or other software making detailed analysis and decisions on the final clustering.

Input selection⚓︎

Positionals
  reads_file                  reads file, in one of the following formats:
                                  - FASTA (.fa/.fasta, .fa.gz/.fasta.gz)
                                  - FASTQ (.fq/.fastq, .fq.gz/.fastq.gz)
                                  - BAM (.bam)
                              Paired-end reads should be merged before given as an input to vidjil-algo.
                              Uncompressed FASTA/FASTQ reads can be given from standard input with '-'.

Input
  -x, --first-reads INT       maximal number of reads to process ('all': no limit, default), only first reads
  -X, --sampled-reads INT     maximal number of reads to process ('all': no limit, default), sampled reads

The main input file of Vidjil-algo is a set of reads, given as a .fasta or .fastq file, possibly compressed with gzip (.gz). This set of reads can reach several gigabytes and 2*109 reads. It is never loaded entirely in the memory, but reads are processed one by one by Vidjil-algo. FASTA/FASTQ reads can also be given on the standard input by giving - instead of a file.

Vidjil-algo can also process BAM files, but please note that:

  1. The reads don't need to be aligned beforehand.
  2. In case of paired-end sequencing, the reads must have already been merged in the BAM file.

The --first-reads option restricts the analysis on a few sequences, for example to probe a large file or to test some parameters. However, read files may be not homogeneous, with bias in the sequences at the start of the file. The --sampled-reads option rather considers regularly sampled sequences from the file. It is thus generally safe to run --sampled-reads 1000 to have a fast insight of what there is in some data.

Germline presets: locus and recombination selection⚓︎

Germline/recombination selection (at least one -g, -V/(-D)/-J, or --find option must be given)
  -g, --germline GERMLINES ...

         -g <.g FILE>(:FOCUS) ...
                    germline preset(s) (.g file(s)), detecting multiple recombinations, with tuned parameters.
                    Common values are '-g germline/homo-sapiens.g' or '-g germline/mus-musculus.g'
                    One can focus on some recombinations, such as in '-g germline/homo-sapiens.g:IGH,IGK,IGL'
         -g PATH
                    human germline preset, shortcut for '-g PATH/homo-sapiens.g',
                    processes human TRA, TRB, TRG, TRD, IGH, IGK and IGL locus, possibly with incomplete/unusal recombinations
  -V FILE ...                 custom V germline multi-fasta file(s)
  -D FILE ...                 custom D germline multi-fasta file(s) for V(D)J designation
  -J FILE ...                 custom V germline multi-fasta file(s)
  --find FILE ...             custom multi-fasta file(s) for non-recombined alignments
  -2                          try to detect unexpected recombinations

The germline/*.g presets configure the analyzed recombinations. The following presets are provided:

  • germline/homo-sapiens.g: Homo sapiens, TR (TRA, TRB, TRG, TRD) and Ig (IGH, IGK, IGL) locus, including incomplete/unusal recombinations (TRA+D, TRB+, TRD+, IGH+, IGK+, see .
  • germline/homo-sapiens-isotypes.g: Homo sapiens heavy chain locus, looking for sequences with, on one side, IGHJ (or even IGHV) genes, and, on the other side, an IGH constant chain.
  • germline/homo-sapiens-isoforms.g: Homo sapiens IKZF1 and ERG recombinations.
  • germline/homo-sapiens-cd.g: Homo sapiens, common CD genes (experimental, does not check for recombinations).
  • germline/mus-musculus.g: Mus musculus (strains BALB/c and C57BL/6)
  • germline/rattus-norvegicus.g: Rattus norvegicus (strains BN/SsNHsdMCW and Sprague-Dawley)

  • Recombinations can be filtered, such as in -g germline/homo-sapiens.g:IGH (only IGH, complete recombinations), -g germline/homo-sapiens.g:IGH,IGH+ (only IGH, as well with incomplete recombinations) or -g germline/homo-sapiens.g:TRA,TRB,TRG (only TR locus, complete recombinations).

  • Several presets can be loaded at the same time, as for instance -g germline/homo-sapiens.g -g germline/germline/homo-sapiens-isotypes.g.

  • Using -2 further test unexpected recombinations (tagged as xxx), as in -g germline/homo-sapiens.g -2. In release 2025.02, this test is limited to detection, not to designations.

Custom reference sequences⚓︎

Some advanced options enable to indicate custom reference sequences, given as .fasta files:

  • The -V/(-D)/-J options indicates a (related) custom repertoire, for V(D)J or V(D)J-like recombinations.

  • The --find option indicates reference sequences, for detection of similarities/alignment of sequences without recombinations. This option works on release 2024.02 but not on release 2025.02.

Several -g/ -V/(-D)/-J / --find options can be used at the same time, describing different systems of (non-)recombinations that will be detected. However, it is not advised to use several time the same reference sequences. More generally, putting many sequences as --find will generate hits that may hide actual recombinations.

Warning

By default uppercase nucleotides in the germline sequences are ignored during the V(D)J designation step. Uppercase nucleotides are intended to be upstream or downstream intronic regions. If you want to disable this behaviour, please use the --keep-uppercase-nucleotides option.

Custom germline/*.g presets⚓︎

New germline/*.g presets for other species or for custom recombinations can be created, possibly referring to other .fasta files. This is an advanced usage, please contact us if you need help in configuring such other germlines.

Inside a .g file, the systems entries details how vidjil-algo looks for recombinations. Let's look at the IGH entry in the germline/homo-sapiens.g preset:

        "IGH": {
            "shortcut": "H",
            "color" : "#6c71c4",
            "description": "Human immunoglobulin, heavy locus (14q32.33)",
            "recombinations": [ {
                "5": ["IGHV.fa"],
                "4": ["IGHD.fa"],
                "3": ["IGHJ+down.fa"]
            } ],
            "parameters": {
                "seed": "12s",
                "search_recombinations": ["5", "3"]
            }
        }

The shortcut must be a unique 1-character string. The color and description fields are not used by vidjil-algo, but rather by the web application. The parameters.seed value of 12s is equivalent to -s 12s advanced option on k-mer size described below. A distinct value can be provided for each recombination with the keys seed_5 and seed_3. The parameters.search_recombinations key tells what kind of recombination has to be searched by the heuristic and in which order. Here we need to find matches with the "5" part and, then, with the "3" part.

Here recombinations describes one sequence analysis mode, called 543: a VJ junction is detected when there is a significant similarity (in terms of numbers of k-mers, see below) against sequences in IGHV.fa in the 5' region, followed by a significant similarity in the 3' region against sequences in IGHJ+down.fa – here we take both J genes and downstream sequences to improve the detection.

In a second pass (V(D)J designation), full alignment is done against these sequences. In this case, all the keys are taken into account, not only the one in the search_recombinations parameter. In the above example, the 4 entry (IGHD.fa) is also considered for the alignment. However, if a D is not detected and designated, the read will be designated as VJ.

The TRD+ entry, for incomplete recombinations (see ), shows an example where both Vd-Dd3, Dd2-Jd (possibly Dd2-Dd-Jd), and Dd2-Dd3 recombinations are searched:

    "recombinations": [ {
        "5": ["TRDV.fa"],
        "3": ["TRDD3+down.fa"]
    }, {
        "5": ["TRDD2+up.fa"],
        "4": ["TRDD.fa"],
        "3": ["TRDJ+down.fa"]
    }, {
        "5": ["TRDD2+up.fa"],
        "3": ["TRDD3+down.fa"]
    } ]

The sequence analysis mode 1, as the command line option --find, detects similarities and designates sequences without recombinations, as in germline/homo-sapiens-cd.g:

     "recombinations": [ { "1": ["CD-sorting.fa"] } ]

Warning: As of release 2025.02, this experimental option is not working anymore.

Main algorithm parameters⚓︎

Recombination detection ("window" prediction, first pass)
    (use either -s or -k option, but not both)
    (using -k option is equivalent to set with -s a contiguous seed with only 'd#' characters)
    (all these options, except -w, are overridden when using -g)
  -k, --kmer INT              k-mer size used for the V/J affectation (default: 10, 12, 13, depends on germline)
  -w, --window INT            w-mer size used for the length of the extracted window ('all': use all the read, no window clustering)
  -e, --e-value FLOAT=1       maximal e-value for trusting the detection of a V-J recombination
  --trim INT                  trim V and J genes (resp. 5' and 3' regions) to keep at most <INT> nt  (0: no trim)
  -s, --seed SEED=10s         seed, possibly spaced, used for the V/J affectation (default: depends on germline), given either explicitely or by an alias
                               10s:#####-##### 12s:######-###### 13s:#######-###### 9c:#########

The -s, -k are the options of the seed-based heuristic that detects "junctions", that is a zone in a read that is similar to V genes on its left end and similar to J genes in its right end. A detailed explanation can be found in (Giraud, Salson and al., 2014). These options are for advanced usage, the default values, as set in the germline/*.g presets, should work. The -s or -k option selects the seed used for the k-mer V/J affectation.

The -w option fixes the size of the "window" that is the main identifier to cluster clones. The default value (-w 50) was selected to ensure a high-quality clone clustering: reads are clustered when they exactly share, at the nucleotide level, a 50 bp-window centered on the CDR3. No sequencing errors are corrected inside this window. The center of the "window", predicted by the high-throughput heuristic, may be shifted by a few bases from the actual "center" of the CDR3 (for TRG, less than 15 bases compared to the IMGT/V-QUEST or IgBlast prediction in >99% of cases when the reads are large enough). Usually, a 50 bp-window fully contains the CDR3 as well as some part of the end of the V and the start of the J, or at least some specific N region to uniquely identify the clone.

Setting -w to higher values (such as -w 60 or -w 100) makes the clone clustering even more conservative, enabling to split clones with low specificity (such as IGH with very large D, short or no N regions and almost no somatic hypermutations). However, such settings may detect recombinations in less reads, depending on the read length of your data, and may also return more clones, as any sequencing error in the window is not corrected.

The special -w all option takes all the read as the windows, completely disabling the clustering by windows and generally returning more clones. This should only be used on datasets where reads of the same clone do have exactly the same length, or in situations in which one want to study very precisely the clonality, tracking all mutations along the read.

Setting -w to lower values than 50 may analyze a few more reads, depending on the read length of your data, but may in some cases falsely cluster reads from different clones. For VJ recombinations, the -w 40 option is usually safe, and -w 30 can also be tested. Setting -w to lower values is not recommended.

When the read is too short too extract the requested length, the window can be shifted (at most 10 bp) or shrunken (down until 30bp) by increments of 5bp. Such reads are counted in SEG changed w and the corresponding clones are output with the W50 warning.

The -e option sets the maximal e-value accepted for analyzing a sequence. It is an upper bound on the number of designated sequences found by chance by vidjil-algo. The e-value computation takes into account both the number of locus searched for and, for the default -c clones command, the number of reads in the input sequence. The default value is 1.0, but values such as 1000, 1e-3 or even less can be used to have a more or less permissive detection and designation. The threshold can be disabled with -e all.

The advanced --e-value-kmer option sets the e-value for the seed-based heuristic. It is an upper bound on the number of expected windows found by chance. The default value is the same than value than the -e.

The advanced --trim option sets the maximal number of nucleotides that will be indexed in V genes (the 3' end) or in J genes (the 5' end). This reduces the load of the indexes, giving more precise window estimation and e-value computation. However giving a --trim may also reduce the probability of seeing a heavily trimmed or mutated V gene. The default is --trim 0.

Thresholds on clone output⚓︎

The following options control how many clones are output and analyzed.

Limits to report and to analyze clones (second pass)
  -r, --min-reads INT=5       minimal number of reads supporting a clone
  --min-ratio FLOAT=0         minimal percentage of reads supporting a clone
  --max-clones INT            maximal number of output clones ('all': no maximum, default)
  -y, --max-consensus INT=100 maximal number of clones computed with a consensus sequence ('all': no limit)
  -z, --max-designations INT=100
                              maximal number of clones to be analyzed with a full V(D)J designation ('all': no limit, do not use)
  --all                       reports and analyzes all clones
                              (--min-reads 1 --min-ratio 0 --max-clones all --max-consensus all --max-designations all),
                              to be used only on small datasets (for example --all -X 1000)

The -r/--ratio options are strong thresholds: if a clone does not have the requested number of reads, the clone is discarded (except when using --label, see below). The default -r 5 option is meant to only output clones that have a significant read support. You should use -r 1 if you want to detect all clones starting from the first read (especially for MRD detection).

The --max-clones option limits the number of output clones, even without consensus sequences.

The --max-consensus option limits the number of clones for which a consensus sequence is computed. Usually you do not need to have more consensus (see below), but you can safely put --max-consensus all if you want to compute all consensus sequences.

The --max-designations option limits the number of clones that are fully analyzed, with their V(D)J designation and an analysis of their CDR3, in particular to enable the web application to display the clones on the grid (otherwise they are displayed on the '?/?' axis).

These V(D)J designations are obtained by full comparison (dynamic programming) with all germline sequences. Note that these designations are relatively slow to compute, especially for the IGH locus. However, they are not at the core of the Vidjil clone clustering method (which relies only on the 'window', see above). To check the quality of these designations, the automated test suite include sequences with manually curated V(D)J designations.

If you want to analyze more clones, you should use --max-designations 200 or --max-designations 500. It is not recommended to use larger values: outputting more than 500 clones is often not useful since they can not be visualized easily in the web application, and takes more computation time.

Note that even if a clone is not in the top 100 (or 200, or 500) but still passes the -r, --ratio options, it is still reported in both the .vidjil and .vdj.fa files. If the clone is at some MRD point in the top 100 (or 200, or 500), it will be fully analyzed by this other point (and then collected by the fuse.py script, using consensus sequences computed at this other point, and then, on the web application, correctly displayed on the grid). Thus is advised to leave the default --max-designations 100 option for the majority of uses.

The --all option disables all these thresholds. This option can be used for test and debug purposes or on small datasets. It produces large file and takes more time.

The --analysis-filter advanced option speeds up the full analysis by a pre-processing step, again based on kmers, to select a subset of the V germline genes to be compared to the read. The option gives the typical size of this subset (it can be larger when several V germlines genes are very similar, or smaller when there are not enough V germline genes). The default --analysis-filter 3 is generally safe. Setting --analysis-filter all removes this pre-processing step, running a full dynamic programming with all germline sequences that is much slower.

CDR3 analysis⚓︎

The full analysis of clones beyond the --max-designations threshold also includes a CDR3/JUNCTION detection and productivity estimation based on the position of Cys104 and Phe118/Trp118 amino acids. The detection relies on alignment with gapped V and J sequences, as for instance, for V genes, IMGT/GENE-DB sequences, as provided by make germline. The CDR3/JUNCTION detection won't work with custom non-gapped V/J repertoires.

CDR3 are reported as productive when they come from an in-frame recombination, the sequence does not contain any in-frame stop codons, and, for IGH recombinations, when the FR4 begins with the {WP}-GxG pattern. This follows the ERIC guidelines (Rosenquist et al., 2017). When a clone is reported as non-productive, the cause is detailed in the seg.junction.unproductive field of the .vidjil output and also in some fields of the AIRR output. Note that some other software only consider stop codons in the CDR3, and may thus under-estimate non-productivity. When the sequence is long enough to start before the start of the V gene or to end after the end of the J gene, vidjil-algo do not consider these intronic sequences in the productivity estimation.

Sequences of interest⚓︎

Vidjil-algo allows to indicate that specific sequences should be followed and output, even if those sequences are 'rare' (below the -r/--ratio thresholds). Such sequences can be provided either with --label <sequence>, or with --label-file <file>. The file given by --label-file should have one sequence by line, as in the following example:

GAGAGATGGACGGGATACGTAAAACGACATATGGTTCGGGGTTTGGTGCT my-clone-1
GAGAGATGGACGGAATACGTTAAACGACATATGGTTCGGGGTATGGTGCT my-clone-2 foo

Sequences and labels must be separated by one space. The first column of the file is the sequence to be followed while the remaining columns consist of the sequence's label. In Vidjil-algo output, the labels are output alongside their sequences.

A sequence given --label <sequence> or with --label-file <file> can be exactly the size of the window (-w, that is 50 by default). In this case, it is guaranteed that such a window will be output if it is detected in the reads. More generally, when the provided sequence differs in length with the windows we will keep any windows that contain the sequence of interest or, conversely, we will keep any window that is contained in the sequence of interest. This filtering will work as expected when the provided sequence overlaps (at least partially) the CDR3 or its close neighborhood, but will not work when the sequence is far of the CDR3 (except when using large -w values or -w all).

With the --label-filter option, only the windows related to the given sequences are kept. This allows to quickly filter a set of reads, looking for a known sequence or window, with the --grep-reads <sequence> preset, equivalent to --out-reads --label-filter --label <sequence>: All the reads with the windows related to the sequence will be extracted to files such as out/seq/clone.fa-1.

Note that such sequences must have been detected as a V(D)J (or V(D)J-like) recombination in the first pass: the --label, -label-file, or --label-filter options can not detect a recombination that was not detected when removing all the thresholds with --all.

To increase the sensitivity, see above the --e-value option, or, to look for non-recombined sequences, see above the --find sequence analysis.

Options for further clone analysis⚓︎

The --several-D option tries to detect several D.

The advanced --analysis-cost option sets the parameters used in the comparisons between the clone sequence and the V(D)J germline genes. The default values should work.

The e-value set by -e is also applied to the V/J designation. The -E advanced option further sets the e-value for the detection of D segments.

Further clustering (experimental)⚓︎

The following options are experimental and have no consequences on the .vdj.fa file, nor on the standard output. They instead add a clusters sections in the .vidjil file that will be visualized in the web application. Any such clustering should be avoided when one wants to precisely study hypermutations. The web application provides other options to inspect clones and cluster them.

The --cluster-epsilon option triggers an automatic clustering using the DBSCAN algorithm (Ester and al., 1996). Using --cluster-epsilon 5 usually clusters reads within a distance of 1 mismatch (default score being +1 for a match and -4 for a mismatch). With that option, more distant reads will also be clustered as soon there are more than 10 reads within the distance threshold. This behavior can be controlled with the -cluster-N option.

Setting --cluster-epsilon 10, possibly with --cluster-N 5 or --cluster-N 1 will perform more aggressive clustering and is generally not advised.

The --cluster-forced-edges option allows to specify a file for manually clustering two windows considered as similar. Such a file may be automatically produced by vidjil-algo (out/edges), depending on the option provided. Only the two first columns (separated by one space) are important to vidjil-algo, they only consist of the two windows that must be clustered.

Output⚓︎

Main output files⚓︎

The default output of Vidjil-algo (with the default -c clones command) are the two following files:

  • The .vidjil file is the main output file, containing the most information. The file is in a .json format, its specification is detailed in vidjil-format. It describes the clones, with the windows and their count, the consensus sequences (--max-consensus), the detailed V(D)J and CDR3 designation (--max-designations, see warning below), and possibly the results of the further clustering.

The web application takes this .vidjil file (possibly merged with fuse.py) for the visualization and analysis of clones and their tracking along different samples (for example time points in a MRD setup or in a immunological study). Please see the web application user manual for more information.

  • The .tsv file is the AIRR output, for compatibility with other software using the same format. See below for details.

By default, these output files are named out/basename.vidjil and out/basename.tsv, where:

  • out is the directory where all the outputs are stored (can be changed with the --dir option).
  • basename is the basename of the input .fasta/.fastq file (can be overridden with the --base option)

With the --gz option, both files are output as compressed .vidjil.gz and .tsv.gz files.

Vidjil-algo also outputs the first 50 clones on the standard output. More data can be printed on the standard output with the -v option.

Auxiliary output files⚓︎

.vdj.fa⚓︎

With the --out-vdjfa option, a .vdj.fa file is created (or, with --gz, a .vdj.fa.gz file). This is a FASTA file for further processing by other bioinformatics tools. Even if it is advised to rather use the full information in the .vijdil file, the .vdj.fa is a convenient way to have sequences of clones for further processing. These sequences are at least the windows (and their count in the headers) or the consensus sequences (--max-consensus) when they have been computed. The headers are described below, but the format of the headers is deprecated and will not be enforced in future releases. Some other information such as the further clustering are not output in this file.

The .vdj.fa output enables to use Vidjil-algo as a filtering tool, shrinking a large read set into a manageable number of (pre-)clones that will be deeply analyzed and possibly further clustered by other software.

.windows.fa⚓︎

The out/basename.windows.fa file contains the list of windows, with number of occurrences:

>8--window--1
TATTACTGTACCCGGGAGGAACAATATAGCAGCTGGTACTTTGACTTCTG
>5--window--2
CGAGAGGTTACTATGATAGTAGTGGTTATTACGGGGTAGGGCAGTACTAC
ATAGTAGTGGTTATTACGGGGTAGGGCAGTACTACTACTACTACATGGAC
(...)

Windows of size 50 (modifiable by -w) have been extracted. The first window has 8 occurrences, the second window has 5 occurrences.

seq/clone.fa-*⚓︎

With the --out-clone-files option, one out/seq/clone.fa-* file is created for each clone. It contains the detailed analysis by clone, with the window, the consensus sequence, as well as with the most similar V, (D) and J germline genes:

>clone-001--IGH--0000008--0.0608%--window
TATTACTGTACCCGGGAGGAACAATATAGCAGCTGGTACTTTGACTTCTG
>clone-001--IGH--0000008--0.0608%--lcl|FLN1FA001CPAUQ.1|-[105,232]-#2 - 128 bp (55% of 232.0 bp) + VDJ  0 54 73 84 85 127   IGHV3-23*05 6/ACCCGGGAGGAACAATAT/9 IGHD6-13*01 0//5 IGHJ4*02  IGH SEG_+ 1.946653e-19 1.352882e-19/5.937712e-20
GCTGTACCTGCAAATGAACAGCCTGCGAGCCGAGGACACGGCCACCTATTACTGT
ACCCGGGAGGAACAATATAGCAGCTGGTAC
TTTGACTTCTGGGGCCAGGGGATCCTGGTCACCGTCTCCTCAG

>IGHV3-23*05
GAGGTGCAGCTGTTGGAGTCTGGGGGAGGCTTGGTACAGCCTGGGGGGTCCCTGAGACTCTCCTGTGCAGCCTCTGGATTCACCTTTAGCAGCTATGCCATGAGCTGGGTCCGCCAGGCTCCAGGGAAGGGGCTGGAGTGGGTCTCAGCTATTTATAGCAGTGGTAGTAGCACATACTATGCAGACTCCGTGAAGGGCCGGTTCACCATCTCCAGAGACAATTCCAAGAACACGCTGTATCTGCAAATGAACAGCCTGAGAGCCGAGGACACGGCCGTATATTACTGTGCGAAA
>IGHD6-13*01
GGGTATAGCAGCAGCTGGTAC
>IGHJ4*02
ACTACTTTGACTACTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAG

The --out-reads debug option further output in each out/seq/clone.fa-* files the full list of reads belonging to this clone. The --out-reads option produces large files, and is not recommended in general cases.

Diversity measures⚓︎

Several diversity indices are reported, both on the standard output and in the .vidjil file, for each germline/locus as well as for the entire data:

  • H (index_H_entropy): Shannon's diversity
  • E (index_E_equitability): Pielou's evenness J' (also known as Shannon's equitability)
  • Ds (index_Ds_diversity): Simpson's diversity

E ans Ds values are between 0 (no diversity, one clone clusters all analyzed reads) and 1 (full diversity, each analyzed read belongs to a different clone). These values are computed on the full list of clones, before any further clustering. PCR and sequencing errors can thus lead to slightly over-estimate the diversity.

Reads without detected recombinations⚓︎

Vidjil-algo outputs details statistics on the reads where no recombination was detected Basically, an un-analyzed read is a read where Vidjil-algo cannot identify a window at the junction of V and J genes. To properly analyze a read, vidjil-algo needs that the sequence spans enough V region and J region (or, more generally, 5' region and 3' regions when looking for incomplete or unusual recombinations). The following causes are reported:

UNSEG too short Reads are too short, shorter than the seed (by default between 9 and 13 bp).
UNSEG strand The strand is mixed in the read, with some similarities both with the + and the - strand.
UNSEG too few V/J No information has been found on the read: There are not enough similarities neither with a V gene or a J gene.
UNSEG only V/5 Relevant similarities have been found with some V, but none or not enough with any J.
UNSEG only J/3 Relevant similarities have been found with some J, but none or not enough with any V.
UNSEG ambiguous vidjil-algo finds some V and J similarities mixed together which makes the situation ambiguous and hardly solvable.
UNSEG too short w The junction can be identified but the read is too short so that vidjil-algo could extract the window (by default 50bp). It often means the junction is very close from one end of the read.

Some datasets may give reads with many low UNSEG too few reads:

  • UNSEG too few V/J usually happens when reads share almost nothing with the V(D)J region. This is expected when the PCR or capture-based approach included other regions, such as in whole RNA-seq.

  • UNSEG only V/5 and UNSEG only J/3 happen when reads do not span enough the junction zone. Vidjil-algo detects a “window” including the CDR3. By default this window is 50bp long, so the read needs be that long centered on the junction.

See the user manual for information on the biological or sequencing causes that can lead to few analyzed reads.

Filtering reads⚓︎

Detailed output per read (generally not recommended, large files, but may be used for filtering, as in -uu -X 1000)
  -U, --out-detected          output reads with detected recombinations (in .detected.vdj.fa file)
  -u, --out-undetected
        -u          output undetected reads, gathered by cause, except for very short and 'too few V/J' reads (in *.fa files)
        -uu         output undetected reads, gathered by cause, all reads (in *.fa files) (use only for debug)
        -uuu        output undetected reads, all reads, including a .undetected.vdj.fa file (use only for debug)
  --out-reads                 output all reads by clones (clone.fa-*), to be used only on small datasets
  -K, --out-affects           output detailed k-mer affectation for each read (in .affects file) (use only for debug, for example -KX 100)

Presets
  --filter-reads              filter possibly huge datasets, with a permissive threshold, to extract reads that may have V(D)J recombinations
                              (equivalent to -c detect --out-detected --e-value 1e6 -2)

It is possible to extract all reads with or without detected recombinations, possibly to give them to other software.

  • -U gives a file out/basename.detected.vdj.fa with all reads having a detected V(D)J recombination

    • -u gives a set of files out/basename.UNSEG_* with reads where /no V(D)J recombination was detected/, but with nevertheless some significant similarity to some V/J germline genes,

    • -uu further produce files with all /other/ reads where no V(D)J recombination was detected (including UNSEG too short and UNSEG too few V/J), and -uuu further outputs all these reads in a file out/basename.undetected.vdj.fa.

As these options may generate large files, they are generally not recommended. However, they are very useful in some situations, especially to understand why some dataset gives low detection rate. For example -uu -X 1000 splits the not detected reads from the 1000 first reads.

When processing large datasets, such as RNA-Seq or capture, one may want to pre-filter read by keeping only the ones that potentially harbour a V(D)J recombination. In such a case, the recommended option is to use the --filter-reads preset, that launches Vidjil-algo without clone clustering and analysis, while outputting a out/basename.detected.vdj.fa file. This file contains reads /that may have V(D)J recombinations/, evaluated with a very permissive threshold. The resulting file is usually much smaller on such datasets and can then be transferred or analyzed in-depth more easily. This filtering can also be part of a post-sequencer workflow.

AIRR .tsv output⚓︎

Since version 2018.10, vidjil-algo supports the AIRR format. We export all required fields, some optional fields, as also some custom fields (+). We also propose in fuse.py a way to convert AIRR format to the .vidjil format.

Note that Vidjil-algo is designed to efficiently gather reads from large datasets into clones. By default (-c clones), we thus report in the AIRR format clones. See also What is a clone ?. Using -c designations trigger a separate analysis for each read, but this is usually not advised for large datasets.

Name Type AIRR 1.2 Description
vidjil-algo implementation
locus string Gene locus (chain type). For example, IGH, IGK, IGL, TRA, TRB, TRD, or TRG.
Vidjil-algo outputs all these loci. Moreover, the incomplete recombinations analyzed by vidjil-algo are reported as IGH+, IGK+, TRA+D, TRB+, TRD+, and xxx for unexpected recombinations. See .
duplicate_count number Number of reads contributing to the (UMI) consensus for this sequence. For example, the sum of the number of reads for all UMIs that contribute to the query sequence.
Number of reads gathered in the clone.
sequence_id string Unique query sequence identifier within the file. Most often this will be the input sequence header or a substring thereof, but may also be a custom identifier defined by the tool in cases where query sequences have been combined in some fashion prior to alignment.
This identifier is the (50 bp by default) window extracted around the junction.
clone_id string Clonal cluster assignment for the query sequence.
This identifier is again the (50 bp by default) window extracted around the junction.
warnings (+) string Warnings associated to this clone. See warnings documentation.
sequence string The query nucleotide sequence. Usually, this is the unmodified input sequence, which may be reverse complemented if necessary. In some cases, this field may contain consensus sequences or other types of collapsed input sequences if these steps are performed prior to alignment.
This contains the consensus/representative sequence of each clone.
rev_comp boolean True if the alignment is on the opposite strand (reverse complemented) with respect to the query sequence. If True then all output data, such as alignment coordinates and sequences, are based on the reverse complement of 'sequence'.
Set to null, as vidjil-algo gather reads from both strands in clones
v_call, d_call, j_call string V/D/J gene with allele. For example, IGHV4-59*01.
implemented. In the case of incomplete/unexpected recombinations (locus with a +), we still use v/d/j_call. Note that this value can be null on clones beyond the --max-designations option.
v_sequence_start, v_sequence_end
d_sequence_start, d_sequence_end
j_sequence_start, j_sequence_end
number Start/end position of the V/D/J genes and of the CDR3 in the query sequence (1-based closed interval).
implemented
v_support, j_support number V/J gene alignment E-value, p-value, likelihood.
implemented
junction string Junction region nucleotide sequence, where the junction is defined as the CDR3 plus the two flanking conserved codons.
null
junction_aa string Junction region amino acid sequence.
implemented
cdr3_aa string Amino acid translation of the cdr3 field.
implemented
cdr3_sequence_start, cdr3_sequence_end number Start/end position of the CDR3 in the query sequence (1-based closed interval).
implemented
productive boolean True if the V(D)J sequence is predicted to be productive.
true, false, or null when no CDR3 has been detected
vj_in_frame boolean True if the V and J gene alignments are in-frame.
true, false, or null when no CDR3 has been detected
stop_codon boolean True if the aligned sequence contains a stop codon.
true, false, or null when vj_in_frame is false
sequence_alignment string Aligned portion of query sequence, including any indel corrections or numbering spacers, such as IMGT-gaps. Typically, this will include only the V(D)J region, but that is not a requirement.
null
germline_alignment string Assembled, aligned, fully length inferred germline sequence spanning the same region as the sequence_alignment field (typically the V(D)J region) and including the same set of corrections and spacers (if any).
null
v_cigar, d_cigar, j_cigar string CIGAR strings for the V/D/J gene
null

Currently, we do not output alignment strings. Our implementation of .tsv may evolve in future versions. Contact us if a particular feature does interest you.

Headers in the .vdj.fa files (deprecated)⚓︎

The .vdj.fa format is compatible with the FASTA format.

The FASTA header of each sequence gives some details on the V(D)J recombinations. This format is deprecated in 2021 and should not be used. For post-processing tools needing some of that information, it is thus strongly advised to use either the .vidjil file that contains more information in a structured way, or the AIRR .tsv output.

Examples of use⚓︎

Basic usage⚓︎

On PCR-based datasets with primers in the V(D)J regions (such as EuroClonality-NGS or EuroClonality/BIOMED-2 primer sets), almost all of the reads are expected to be actual V(D)J recombinations. On the other side, typical whole RNA-Seq or capture datasets usually have only a (very) small portion of recombined sequences. The following commands work in both cases, detecting the locus for each recombined read, clustering such reads into clones, and further analyzing the clones.

./vidjil-algo -c clones   -g germline/homo-sapiens.g -2 -r 1  demo/Demo-X5.fa
  # Detect the locus for each read, cluster and report clones starting from the first read (-r 1).
  # including unexpected recombinations (-2). Designate the V(D)J genes and analyze the CDR3s.
  # Demo-X5 is a collection of sequences on all human locus, including some incomplete or unusual recombinations:
  # IGH (VDJ, DJ), IGK (VJ, V-KDE, Intron-KDE), IGL, TRA, TRB (VJ, DJ), TRG and TRD (VDDJ, Dd2-Dd3, Vd-Ja).
./vidjil-algo -g germline/homo-sapiens.g:IGH demo/Stanford_S22.fasta
   # Cluster the reads and report the clones, based on windows overlapping IGH CDR3s.
   # Designate the V(D)J genes and analyze the CDR3 of each clone.
   # Main output files are both out/Stanford_S22.vidjil and out/Stanford_S22.tsv.
   # Summary of clones is available on stdout.
./vidjil-algo -g germline/homo-sapiens.g -2 -d demo/Stanford_S22.fasta
   # Detects for each read the best locus, including an analysis of incomplete/unusual and unexpected recombinations
   # Cluster the reads into clones, again based on windows overlapping the detected CDR3s.
   # Designate the VDJ genes (including multiple D) and analyze the CDR3 of each clone.
   # Main output files are both out/reads.vidjil and out/reads.tsv.
   # Summary of clones is available on stdout.

Sorting reads from whole RNA-Seq or capture datasets⚓︎

./vidjil-algo -g germline/homo-sapiens.g -2 -U demo/Stanford_S22.fasta
   # Detects for each read the best locus, including an analysis of incomplete/unusual and unexpected recombinations
   # Cluster the reads into clones, again based on windows overlapping the detected CDR3s.
   # Designate the VDJ genes and analyze the CDR3 of each clone.
   # The out/reads.detected.vdj.fa include all reads where a V(D)J recombination was found

Typical whole RNA-Seq or capture datasets may be huge (several GB) but with only a (very) small portion of recombined sequences. Using Vidjil with -U will create a out/reads.detected.vdj.fa file that includes all reads where a V(D)J recombination (or an unexpected recombination, with -2) was found. This file will be relatively small (a few kB or MB) and can be taken again as an input for Vidjil-algo or for other programs.

Note that for RNA-Seq or capture data, it is advised to stay on release 2024.02.

Advanced usage⚓︎

An experimental further clustering can be triggered with --cluster-epsilon.

./vidjil-algo -c clones -g germline/homo-sapiens.g -r 1 --cluster-epsilon 5 -x 10000 demo/LIL-L4.fastq.gz
   # Extracts the windows with at least 1 read each (-r 1, the default being -r 5)
   # on the first 10,000 reads, then cluster them into clones
   # with a second clustering step at distance five (--cluster-epsilon 5)
   # The result of this second is in the .vidjil file ('clusters')
   # and can been seen and edited in the web application.

The V(D)J designation is usually run at the end of the clones detection (default command -c clones, on a number of clones limited by the --max-designations option). It is also possible to explicitly require V(D)J designation for each read (-c designations, no clone clustering, not recommended for large datasets)

./vidjil-algo -c designations -g germline/homo-sapiens.g -2 -d -x 50 demo/Stanford_S22.fasta
   # Detailed V(D)J designation, including multiple D, and CDR3 analysis on the first 50 reads, without clone clustering
   # (this is not as efficient as '-c clones', no clustering)

The command -c germlines outputs statistics on k-mers.

./vidjil-algo -c germlines -g germline/homo-sapiens.g demo/Stanford_S22.fasta
   # Output statistics on the number of occurrences of k-mers of the different germlines

Following clones in several samples⚓︎

The goal of many immune repertoire sequencing (RepSeq) studies is to follow clones with V(D)J recombinations across several samples. This can be in a minimal residual disease (MRD) setup, tracking the clones found at the diagnosis in follow-up points, or more generally in any immunological study comparing samples from the same person or from different people.

The .vidjil file output by vidjil-algo keeps track of some clones in one sample, limited by --max-clones. By default all the clones of the sample are kept (--max-clones all), even if the V(D)J designation is computed only for some of them.

The tools/fuse.py script, as documented here, merge several .vidjil files into a single one that can then be fed to the web client:

python tools/fuse.py --output out.vidjil --top 100 sample1.vidjil sample2.vidjil sample3.vidjil

As the --top value is equal or below the default --max-designations 100, it means that every clone in the "merged" file will be fully analyzed with a V(D)J designation. Thus is advised to leave, in vdijil-algo the default --max-clones all --max-designations 100 options for the majority of uses.