Specification of the .vidjil format
Encoding clones with V(D)J recombinations with .vidjil files⚓︎
The following .json format (2016b) allows to encode a set of clones (formally, clonotypes) with V(D)J immune recombinations, possibly with user annotations.
In Vidjil, this format is used by both the .analysis and the .vidjil files.
The .vidjil file represents the actual data on clones (and that can
reach megabytes, or even more), usually produced by processing reads by some RepSeq software.
(for example with detailed information on the 100 or 1000 top clones).
The .analysis file describes customizations done by the user
(or by some automatic pre-processing) on the Vidjil web application. The web application
can load or save such files (and possibly from/to the patient/sample database).
It is intended to be very small (a few kilobytes).
All settings in the .analysis file override the settings that could be
present in the .vidjil file.
What is a clone ?⚓︎
There are several definitions of what may be a clonotype,
depending on different RepSeq software or studies.
This format accept any kind of definition:
Clonotypes are identified by a id string that may be an arbitrary identifier such as clone-072a.
Software computing clonotypes may choose some relevant identifiers:
CGAGAGGTTACTATGATAGTAGTGGTTATTACGGGGTAGGGCAGTACTAC, Vidjil algorithm, 50 nt window centered on the CDR3CARPRDWNTYYYYGMDVW, a CDR3 AA sequenceCARPRDWNTYYYYGMDVW IGHV3-11*00 IGHJ6*00, a CDR3 AA sequence with additional V/J gene information (MiXCR)- the 'clone sequence' as computed by the ARReST in
.clntabfiles (processed byfuse.py) - see also 'IMGT clonotype (AA) or (nt)'
Examples⚓︎
.vidjil file – one sample⚓︎
Vidjil
A vidjil json schema is available to https://gitlab.inria.fr/vidjil/vidjil-format and allow to check is a file is coherent with vidjil expected format.
This tool is also use to test validity of script able to modify vidjil file.
This is an almost minimal .vidjil file, describing clones in one sample.
The seg element is optional: clones without seg elements will be shown on the grid with '?/?'.
The _average_read_length is also optional, but allows to plot GENSCAN-like plots more precisely than getting only the length of the sequence.
All other elements are required. The reads.germlines list can have only one element the case of data on a unique locus.
There is here one clone on the TRG locus with a designation (name) TRGV5*01 5/CC/0 TRGJ1*02.
Note that this name is just used to name the clone.
The actual values used for X- and Y- axis in the V/J grid plot are seg.5.name and seg.3.name fields.
Note that other elements could be added by some program (such as tag, to identify some clones,
or clusters, to further cluster some clones, see below).
Since release web-2025-10, you can include analysis content inside vidjil filen under analysis key. This allow to have some process that pre-compute some extra-information as clustering.
{
"producer": "program xyz version xyz",
"timestamp": "2014-10-01 12:00:11",
"vidjil_json_version": "2016b",
"samples": {
"number": 1,
"original_names": [
"T8045-BC081-Diag.fastq"
],
"commandline": [
"vidjil-algo -g germline/homo-sapiens.g -Z 100 -r 1 -3 Diag.fastq"
]
},
"reads": {
"total": [
437164
],
"segmented": [
335662
],
"germline": {
"TRG": [
250000
],
"IGH": [
85662
]
},
"clones": {
"TRG": [
2500
],
"IGH": [
856
]
}
},
"clones": [
{
"id": "clone-001",
"name": "TRGV5*01 5/CC/0 TRGJ1*02",
"sequence": "CTCATACACCCAGGAGGTGGAGCTGGATATTGATACTACGAAATCTAATTGAAAATGATTCTGGGGTCTATTACTGTGCCACCTGGGCCTTATTATAAGAAACTCTTTGGCAGTGGAAC",
"reads": [
243241
],
"_average_read_length": [
119.3
],
"germline": "TRG",
"top": 1,
"seg": {
"5": {
"name": "TRGV5*01",
"start": 1,
"stop": 87,
"delRight": 5
},
"3": {
"name": "TRGJ1*02",
"start": 89,
"stop": 118,
"delLeft": 0
},
"cdr3": {
"start": 78,
"stop": 105,
"seq": "gccacctgggccttattataagaaactc"
}
}
}
],
"analysis": {
"clusters": [
"clone-001"
]
}
}
.vidjil file – several related samples⚓︎
This a .vidjil file obtained by merging with fuse.py two .vidjil files corresponding to two samples.
Clones that are from different files but that have a same id are gathered (see 'What is a clone?', above).
It is the responsibility of the program generating the initial .vidjil files to choose these id to
do a correct gathering.
{
"producer": "program xyz version xyz / fuse.py version xyz",
"timestamp": "2014-10-01 14:00:11",
"vidjil_json_version": "2016b",
"samples": {
"number": 2,
"original_names": ["T8045-BC081-Diag.fastq", "T8045-BC082-fu1.fastq"],
"timestamp": [
"2019-12-17 17:49:22",
"2019-12-27 17:50:04"
],
"commandline": [
"vidjil-algo -g germline/homo-sapiens.g -Z 100 -r 1 -3 Diag.fastq",
"vidjil-algo -g germline/homo-sapiens.g -Z 100 -r 1 -3 FollowUp1.fastq"
],
"commandline_fuse": "fuse.py -o fused.vidjil -t 100 T8045-BC081-Diag.vidjil T8045-BC082-fu1.vidjil"
},
"reads" : {
"total" : [ 437164, 457810 ] ,
"segmented" : [ 335662, 410124 ] ,
"germline" : {
"TRG" : [ 250000, 300000 ] ,
"IGH" : [ 85662, 10124 ]
},
"clones": {
"TRG" : [ 2500, 3000 ] ,
"IGH" : [ 856, 101 ]
}
},
"clones": [
{
"id": "clone-001",
"sequence": "CTCATACACCCAGGAGGTGGAGCTGGATATTGATACTACGAAATCTAATTGAAAATGATTCTGGGGTCTATTACTGTGCCACCTGGGCCTTATTATAAGAAACTCTTTGGCAGTGGAAC",
"reads" : [ 243241, 14717 ],
"germline": "TRG",
"top": 1,
"seg":
{
"5": {"name": "TRGV5*01", "start": 1, "stop": 87, "delRight": 5},
"3": {"name": "TRGJ1*02", "start": 89, "stop": 118, "delLeft": 0},
"quality": {
"start": 1,
"stop": 118,
"seq": "!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!TAATTGAAAATGATTCTGGGGTCTATTACTGTGCCACCTGGGCCTTATTATAAGA!!!!!!!!!!!!!!!!!!!"
}
}
},
{
"id": "clone2",
"sequence": "GATACA",
"reads": [ 153, 10221 ],
"germline": "TRG",
"top": 2
},
{
"id": "clone3",
"sequence": "ATACAGA",
"reads": [ 521, 42 ],
"germline": "TRG",
"top": 3,
"seg":
{
"5": {"start": 1, "stop": 100},
"3": {"start": 101, "stop": 200}
}
},
{
"id": "seqedited_in_analysis",
"name": "name_seqedited_in_analysis",
"sequence": "AAAAATTTTTAAAAATTTTTAAAAATTTTT",
"reads": [ 521, 42 ],
"germline": "TRG",
"top": 4,
"seg":
{
"cdr3": {"start": 10, "stop": 20}
}
},
{
"id": "clone5",
"name": "clone_showOnlyOneSample",
"sequence": "GATACAaaaaaccccc",
"reads": [ 1021, 0 ],
"germline": "TRG",
"top": 5
},
{
"id": "clone_cluster1",
"name": "clone_cluster1",
"sequence": "GATACAaaaaaccccc",
"reads": [ 1021, 0 ],
"germline": "TRG",
"top": 6
},
{
"id": "clone_cluster2",
"name": "clone_cluster2",
"sequence": "AAAAATTTTTAAAAATTTTTAAAAATTTTT",
"reads": [ 521, 42 ],
"germline": "TRG",
"top": 7,
"seg":
{
"cdr3": {"start": 10, "stop": 20}
}
}
]
}
Note that we add a field in samples part to keep trace of commandline used for fuse call. This allows to get important info on pre-fuse/post-fuse called.
.vidjil file - pre process data⚓︎
If a pre process has been used to produce a file in the pipeline its data can be fused into the .vidjil file.
{
"producer": "program xyz version xyz",
"timestamp": "2014-10-01 12:00:11",
"vidjil_json_version": "2016b",
"samples": {
"number": 1,
"original_names": ["T8045-BC081-Diag.fastq"],
"pre_process": {
"stats": {
...
},
"parameters": {
...
}
}
},
"reads" : {
"total" : [ 437164 ] ,
"segmented" : [ 335662 ] ,
"germline" : {
"TRG" : [ 250000 ] ,
"IGH" : [ 85662 ]
},
"clones": {
"TRG" : [ 2500 ],
"IGH" : [ 856 ]
},
"merged" : [ 437164 ]
},
"clones": [
{
"id": "clone-001",
"name": "TRGV5*01 5/CC/0 TRGJ1*02",
"sequence": "CTCATACACCCAGGAGGTGGAGCTGGATATTGATACTACGAAATCTAATTGAAAATGATTCTGGGGTCTATTACTGTGCCACCTGGGCCTTATTATAAGAAACTCTTTGGCAGTGGAAC",
"reads" : [ 243241 ],
"_average_read_length": [ 119.3 ],
"germline": "TRG",
"top": 1,
"seg":
{
"5": {"name": "TRGV5*01", "start": 1, "stop": 87, "delRight":5},
"3": {"name": "TRGJ1*02", "start": 89, "stop": 118, "delLeft":0},
"cdr3": { "start": 78, "stop": 105, "seq": "gccacctgggccttattataagaaactc" }
}
}
]
}
.analysis file⚓︎
This file reflects the annotations a user could have done within the Vidjil web application or some other tool.
She has manually set sample names (names), tagged (tag, tags), named (name) and clustered (clusters)
some clones, and added external data (data).
{
"producer": "user Bob, via Vidjil webapp",
"timestamp": "2014-10-01 12:00:11",
"vidjil_json_version": "2016b",
"samples": {
"id": [
"T8045-BC081-Diag.fastq",
"T8045-BC082-fu1.fastq"
],
"number": 2,
"names": ["diag", "fu1"],
"order": [1, 0],
"stock_order": [1, 0]
},
"clones": [
{
"id": "clone-001",
"name": "Main ALL clone",
"tag": "0"
},
{
"id": "spikeE",
"label": "spike",
"sequence": "ATGACTCTGGAGTCTATTACTGTGCCACCTGGGATGTGAGTATTATAAGAAAC",
"tag": "3",
"expected": "0.1"
},
{
"id": "seqedited_in_analysis",
"segEdited": true,
"germline": "TRG",
"sequence": "GGGGGCCCCCGGGGGCCCCCGGGGGCCCCCGGGGGCCCCCAAAAATTTTTAAAAATTTTTAAAAATTTTT",
"reads": [ 521, 42 ],
"seg":
{
"cdr3": {"start": 50, "stop": 60}
}
},
{
"id": "seqedited_new_locus",
"segEdited": true,
"germline": "IGH+",
"name": "clone_with_new_locus"
}
],
"clusters": [
[ "clone3", "clone2"],
[ "clone_cluster2", "clone_cluster1"],
[ "clone-5", "clone-10", "clone-179" ]
],
"data": {
"qPCR": [0.83, 0.024],
"spikeZ": [0.01, 0.02]
},
"tags": {
"names": {
"0" : "main clone",
"3" : "spike",
"5" : "custom tag"
},
"hide": [4, 5]
}
}
The stock_order and order fields define the order in which the points should be considered.
stock_ordercontains the order for all the existing samples and thus remembers positions of each samples, hidden or not.orderonly remembers the currently shown samples.
In the example above we should first consider the second point (whose name
is fu1) and the point to be considered in second should be the first one in
the file (whose name is diag).
If order value was [1], only the second sample would be shown and the first would be hidden.
In such a case stock_order should still contain two values.
The clusters field indicate clones (by their id) that have been further clustered.
Usually, these clones were defined in a related .vidjil file (as clone2 and clone3,
see the .vidjil file in the previous section). If these clones do not exist, the clusters are
just ignored. The first item of the cluster is considered as the
representative clone of the cluster.
Detailed specification⚓︎
Generic information for traceability [required]⚓︎
"producer": "my-repseq-software -z -k (v. 123)", // arbitrary string, user/software/version/options producing this file [required]
"timestamp": "2014-10-01 12:00:11", // last modification date [required]
"vidjil_json_version": "2016b", // version of the .json format [required]
Statistics: the reads element [.vidjil only, required]⚓︎
The number of reads with detected recombinations (segmented)
may be higher than the sum of the read number of all clones,
when one choose to report only the 'top' clones (-t option for fuse).
{
"total" : [], // total number of reads per sample (with samples.number elements)
"segmented" : [], // number of reads with detected recombinations per sample (with samples.number elements)
"germline" : { // number of reads with detected recombinations per sample/germline (with samples.number elements)
"TRG" : [],
"IGH" : []
}
}
samples element [required]⚓︎
{
"number": 2, // number of samples [required]
"original_names": [], // original sample names (with samples.number elements) [required]
"names": [], // custom sample names (with samples.number elements) [optional]
// These names are editable and will be used on the graphs
"order": [], // custom sample order (lexicographic order by default) [optional]
// traceability on each sample (with sample.number elements)
"producer": [],
"timestamp": [],
"log": []
// Supplementary data [optional]
"supplementary_data": {
"mrd": {
"normalization": [], // list of boolean wether the sample had mrd normalization data or not
"outliers": [ // list of outliers spikes
{
"IGH": { // locus with outliers spikes
"outlier spike name": { // name of outlier spikes
"factor": float // value ouf the outlier spike factor
}
}
}
],
"sensitivity" : [], // sensitivity computed for this sample
"total_cells": [], // total number of cells used for normalization
"total_normalized_reads": [], // total number of normalized reads WITHOUT spike reads
"locus_normalization_factor": { // list of normalization factor for each locus
"IGH": [
{
"lower_bound": float,
"upper_bound": float,
"value": float
}
]
}
}
clones list, with read count, tags, V(D)J designation and other sequence features⚓︎
Each element in the clones list describes properties of a clone.
In a .vidjil file, this is the main part, describing all clones.
In the .analysis file, this section is intended to describe some specific clones.
{
"id": "", // clone identifier, must be unique [required] [see above, 'What is a clone ?']
// the clone identifier in the .vidjil file and in .analysis file must match
"germline": "" // [required for .vidjil]
// (should match a germline defined in germline/germline.data)
"name": "", // clone custom name [optional]
// (the default name, in .vidjil, is computed from V/D/J information)
"label": "", // clone labels, separated by spaces [optional]
// These labels may add some information entered with a controlled vocabulary
"sequence": "", // reference nt sequence [required for .vidjil]
// (for .analysis, not really used now in the web application,
// for special clones/sequences that are known,
// such as standard/spikes or know patient clones)
"tag": "", // tag id from 0 to 7 (see below) [optional]
"expected": "" // expected abundance of this clone (between 0 and 1) [optional]
// this will create a normalization option in the
// settings web application menu
"seg": // detailed V(D)J designation/segmentation and other sequences features or values [optional]
// on the web application, clones that are not detected will be shown on the grid with '?/?'
// positions are related to the 'sequence'
// names of V/D/J genes should match the ones in files referenced in germline/germline.data
// Positions on the sequence start at 1.
{
"5": {"name": "IGHV5*01", "start": 1, "stop": 120, "delRight": 5}, // V (or 5') segment
"4": {"name": "IGHD1*01", "start": 124, "stop": 135, "info": "unsure designation", "delRight": 5, "delLeft": 0}, // D (or middle) segment
// Recombination with several D may use "4a", "4b"...
"3": {"name": "IGHJ3*02", "start": 136, "stop": 171, "delLeft": 5}, // J (or 3') segment
// Any feature to be highlighted in the sequence.
// All those fields are optional (though some minor feature may not properly work in the client)
// - "start"/"stop" : positions on the clone sequence (starting at 1)
// - "delLeft/delRight" : a numerical value . It is the numbers of nucleotides deleted during the rearrangement. DelRight are compatible with V/5 and D/4 segments, delLeft is compatible with D/4 and J/3 segments.
// - "seq" : a sequence
// - "val" : a numerical value
// - "info" : a textual value
"somefeature": { "start": 56, "stop": 61, "seq": "ACTGTA", "val": 145.7, "info": "analyzed with xyz" },
// Numerical or textual features concerning all the sequence or its analysis (such as 'evalue')
// can be provided by omitting "start" and "stop" elements.
"someotherfeature": {"val": 0.004521},
"anotherfeature": {"info": "VH CDR3 stereotypy"},
// JUNCTION//CDR3 should be stored that way (in fields called "junction" or "cdr3"),
// Its productivity must be stored in a boolean field called "productive".
// When the sequence is not productive, the "unproductive" field may contain the reason (mainly "stop-codon" or "out-of-frame")
// "seq" field should not be filled for cdr3 or junction (it is extracted from the sequence itself).
// However a "aa" field may be used to give the amino-acid translation of the cdr3 or junction.
"junction": { "start": 41, "stop": 82, "aa": "CATWDRKNYYKKLF", "productive": false, "unproductive": "stop-codon" },
}
"reads": [], // number of reads in this clones [.vidjil only, required]
// (with samples.number elements)
"_average_read_length": [],
// Average read length of the reads clustered in this clone.
// This value allows to draw a genescan-like plot.
// (with samples.number elements)
"top": 0, // (not documented now) [required] threshold to display/hide the clone
"stats": [] // (not documented now) [.vidjil only] (with sample.number elements)
"warn": [] // Warnings related to this clone [optional]
"supplementary_data": { // supplementary data [optional]
"mrd" : { // Supplementary data about MRD
"is_spike": [true or false] // Wether the clone is a spike clone or not
"is_missing": [true or false] // Wether the clone, if it is a spike, is missing or not
"is_outlier": [true or false] // Wether the clone, if it is a spike, is an outlier for normalization factor or not
"spike_normalization_factor": [float] // Normalization factor computed for this clone if it is a spike
"locus_normalization_factor": [float] // Normalization factor computed for the locus of this clone
"normalized_reads": [float] // Normalized number of reads, computed with the number of reads and the normalization factor
"normalized_cells": [int] // Normalized number of cells, computed with the normalized reads and the number of expected cells
}
}
}
distributions: providing statistics on full clonal populations⚓︎
In some situations, one would like to represent whole distributions of clones
according to "axes" such as V/J distribution or length.
It is possible to specify in the .vidjil file such "distributions"
without detailing the full list of clones, hence keeping a relatively small file
and enabling fast post-processing or visualizations.
In the example below, 5 clones (totaling 6 reads) have a length of 223. Distributions can be on several axes, like both V/J (here seg3/seg5).
{
"distributions":
{
"keys": ["clones", "reads"],
"repertoires": {
"sample_42": [
{
"axes": ["lenSeqAverage"],
"values": { "223": [5, 6], "232": [1, 7], "260": [5, 20] }
},
{
"axes": ["seg3", "seg5"],
"values": {
"IGHJ3": {"IGHV4-39": [5, 20]},
"IGHJ4": {"IGHV3-23": [1, 7], "IGHV3-64": [1, 1]},
"IGHJ6": {"IGHV1-24": [2, 3], "IGHV1-8": [2, 2]}
}
}]
}
}
}
}
Distributions from a .vidjil files can be computed by tools/fuse.py,
giving the desired list of distributions
through the -d option. For the above example, run:
python fuse.py -d lenSeqAverage -d seg3,seg5 sample_42.vidjil
The command fuse.py -l yields the list of available axes,
but currently only lenSeqAverage and seq3,seq5 are supported.
Adding axes can be done trough in get_values() in tools/fuse.py.
Note that axes should also be added to browser/js/axis_conf.js to be displayed in the client.
germlines list [optional][work in progress, to be documented]⚓︎
Extend the germline.data default file with a custom germline.
"germlines" : {
"custom" : {
"shortcut": "B",
"5": ["TRBV.fa"],
"4": ["TRBD.fa"],
"3": ["TRBJ.fa"]
}
}
MRD data [optional]⚓︎
Vidjil offers support for the use of spike-ins to serve as a yardstick to obtain copy numbers from read counts, with the goal of estimating Minimal Residual Disease (MRD) values. To use this feature, users should:
- add spike-ins in known copy numbers in their lab preps
- inform
vidjil-algothe sequences and copy numbers of these spike-ins - add a pre-processing step in the analysis configuration to insert
the normalized values (MRD estimations) into the
vidjilfile
The web application can then take the info from the vidjil file and
display it.
To inform vidjil-algo of the spike-in sequences and copy numbers, a
file in JSON format must be provided, as in the following example:
{
"config": {
"labels": [
{
"name": "spike-1",
"copies": "10",
"sequence": "GGAACTGGGCCTGGGGATACGGAAATATCGGTACACCGATAAAC",
"family": "TRDV1",
"locus": "TRD"
},
{
"name": "spike-2",
"copies": "40",
"sequence": "GGGAATACCTCGGTGCGGTGGGGGATCCCAAGACCCCCCTCTACACCGATAA",
"family": "TRDV1",
"locus": "TRD"
},
{
"name": "spike-3",
"copies": "160",
"sequence": "GCTCTTGGGGTGCATCAGTCCATGACCCACCGATAAACTCATC",
"family": "TRDV1",
"locus": "TRD"
}
]
}
}
and given to vidjil-algo by means of the flag --label-json
spikes.json. Notice that the family of each spike-in must be
informed as well, because it has been determined that performing the procedure within a family yields better results.
In the results, you will get a supplementary_data.mrd key at the clone level :
"supplementary_data": { // supplementary data [optional]
"mrd" : { // Supplementary data about MRD
"is_spike": [true or false] // Wether the clone is a spike clone or not
"is_missing": [true or false] // Wether the clone, if it is a spike, is missing or not
"is_outlier": [true or false] // Wether the clone, if it is a spike, is an outlier for normalization factor or not
"spike_normalization_factor": [float] // Normalization factor computed for this clone if it is a spike
"locus_normalization_factor": [float] // Normalization factor computed for the locus of this clone
"normalized_reads": [float] // Normalized number of reads, computed with the number of reads and the normalization factor
"normalized_cells": [int] // Normalized number of cells, computed with the normalized reads and the number of expected cells
}
}
and a supplementary_data.mrd key at the sample level :
"supplementary_data": { // Supplementary data [optional]
"mrd": {
"normalization": [], // list of boolean wether the sample had mrd
// normalization data or not
"outliers": [ // list of outliers spikes
{
"IGH": { // locus with outliers spikes
"outlier spike name": { // name of outlier spikes
"factor": float // value ouf the outlier spike factor
}
}
}
],
"sensitivity" : [], // sensitivity computed for this sample
"total_cells": [], // total number of cells used for normalization
"total_normalized_reads": [], // total number of normalized reads WITHOUT spike reads
"locus_normalization_factor": { // list of normalization factor for each locus
"IGH": [
{
"lower_bound": float,
"upper_bound": float,
"value": float
}
]
}
}
⚠️ The following paragraphs are part of old MRD calculation and will be deprecated.
The following paragraphs are part of old MRD calculation and will be deprecated.
For the pre-processing step, Vidjil offers a script called
spike-normalization.py, so one can add a line such as the following
one to the Fuse command: field in the analysis config:
-t 100 --pre spike_normalization.py
The spike-normalization.py script is responsible for collecting read
counts for the spike-ins, combining them with their copy numbers, and
computing normalized values from the read counts of other clones in
the same family. If a family does not have at least 3 spike-ins, or
if its linear regression's Person R2 coefficient is below 0.8, a
universal normalization is used instead. The universal normalization
takes into consideration all spike-ins from all families.
With this, the Vidjil web interface will show a normalized value, intended as an estimate of the MRD value, instead of the usual read percentage for each clone. To switch between displaying normalized values or read percentages, the corresponding option in the setting menu can be used.
Only clones from the prevalent germline, that is, the germline with more reads in the sample, are normalized by this process.
The information flow of normalization is as follows. The
post-analysis script tools/spike-normalization.py writes multiple
data fields in the vidjil file. Part of the info is set into an
mrd field, and contains data for each sample.
"mrd": {
"coefficients": {
"IGHV5": 0.15380390002746497,
"UNI": 0.15380390002746497,
"IGHV1": 0.15380390002746497
},
"UNI_R2": [
0.964285714285714
],
"ampl_coeff": [
64.89233726998077
],
"prevalent": [
"IGK"
]
}
The item coefficients, one per family, contains the coefficients that
multiplied by a read count will yield a normalized value. Here, UNI
stands for the universal coefficient, based on all spike-ins. Field
UNI_R2 shows the Pearson R2 coefficient of the linear regression for
the universal coefficient. Field ampl_coeff contains the ratio
between the total number of reads captured by Vidjil and spike-in
reads. Although not used in calculations, it is an important
parameter to assess the quality of the sample. If spike-ins reads
make up too large a fraction of the entire collection, this can lead
to distortions. Finally, prevalent indicates the prevalent germline
in the sample.
The remaining set of fields is set into each clone, under key mrd,
and are arrays containing one value per time point.
"clones": [
{
...
"mrd": {
"R2": [ 0.95 ],
"copy_number": [ 41.37324910738808 ],
"family": [ "UNI" ],
"norm_coeff": [ 0.11118547904332683 ]
},
"normalized_reads": [ 195.50763372699805 ]
}
]
Here, field R2 indicates the Pearson R2 coefficient for the linear
regression used in this clone; copy_number is the estimated copy
number of this clone, obtained by multiplying this clone's coefficient
by its read count; family is the clone family; and
normalized_reads is the estimated value of MRD for this clone.
Further clustering of clones: the clusters list [optional]⚓︎
Each element in the 'clusters' list describe a list of clones that are 'merged'. In the web application, it will be still possible to see them or to unmerge them. The first clone of each line is used as a representative for the cluster.
data list [optional][work in progress, to be documented]⚓︎
Each element in the data list is a list of values (of size samples.number)
showing additional data for each sample, as for example qPCR levels or spike information.
In the browser, it will be possible to display these data and to normalize against them (not implemented now).
Tagging some clones: tags list [optional]⚓︎
The tags list describe the custom tag names as well as tags that should be hidden by default.
The default tag names are defined in ../browser/js/vidjil-style.js.
"key" : "value" // "key" is the tag id from 0 to 7 and "value" is the custom tag name attributed